The QuasR
package (short for Quantify and annotate short
reads in R) integrates the functionality of several
R packages (such as IRanges
(Lawrence et al. 2013) and Rsamtools)
and external software (e.g. bowtie, through the Rbowtie
package, and HISAT2, through the Rhisat2
package). The package aims to cover the whole analysis workflow of
typical high throughput sequencing experiments, starting from the raw
sequence reads, over pre-processing and alignment, up to quantification.
A single R script can contain all steps of a complete
analysis, making it simple to document, reproduce or share the workflow
containing all relevant details.
The current QuasR release supports the analysis of single read and paired-end ChIP-seq (chromatin immuno-precipitation combined with sequencing), RNA-seq (gene expression profiling by sequencing of RNA) and Bis-seq (measurement of DNA methylation by sequencing of bisulfite-converted genomic DNA) experiments. It has been successfully used with data from Illumina, 454 Life Technologies and SOLiD sequencers, the latter by using bam files created externally of QuasR.
If you use QuasR (Gaidatzis et al. 2015) in your work, you can cite it as follows:
## Please use the QuasR reference below to cite the software itself. If
## you were using qAlign with Rbowtie as aligner, it can be cited as
## Langmead et al. (2009) (unspliced alignments) or Au et al. (2010)
## (spliced alignments). If you were using qAlign with Rhisat2 as aligner,
## it can be cited as Kim et al. (2015).
##
## Gaidatzis D, Lerch A, Hahne F, Stadler MB. QuasR: Quantification and
## annotation of short reads in R. Bioinformatics 31(7):1130-1132
## (2015).
##
## Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and
## memory-efficient alignment of short DNA sequences to the human
## genome. Genome Biology 10(3):R25 (2009).
##
## Au KF, Jiang H, Lin L, Xing Y, Wong WH. Detection of splice junctions
## from paired-end RNA-seq data by SpliceMap. Nucleic Acids Research,
## 38(14):4570-8 (2010).
##
## Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with
## low memory requirements. Nat Methods, 12(4):357-60 (2015).
##
## This free open-source software implements academic research by the
## authors and co-workers. If you use it, please support the project by
## citing the appropriate journal articles.
##
## To see these entries in BibTeX format, use 'print(<citation>,
## bibtex=TRUE)', 'toBibtex(.)', or set
## 'options(citation.bibtex.max=999)'.
QuasR is a package for the R computing environment and it is assumed that you have already installed R. See the R project at (http://www.r-project.org). To install the latest version of QuasR, you will need to be using the latest version of R. QuasR is part of the Bioconductor project at (http://www.bioconductor.org). To get QuasR together with its dependencies you can use
Bioconductor works on a 6-monthly official release cycle. As with
other Bioconductor packages, there are always two versions of QuasR. Most
users will use the current official release version, which will be
installed by BiocManager::install if you are using the
current release version of R. There is also a
development version of QuasR that
includes new features due for the next official release. The development
version will be installed if you are using the development version of
Bioconductor (see version = "devel" in
BiocManager).
The official release version always has an even second number (for
example 1.20.1), whereas the developmental version has an odd second
number (for example 1.21.4).
In order to run the code examples in this vignette, the QuasR package and a few additional packages need to be loaded:
Most questions about QuasR will hopefully be answered by the documentation or references. If you’ve run into a question which isn’t addressed by the documentation, or you’ve found a conflict between the documentation and software, then there is an active support community which can offer help.
The authors of the package (maintainer: Michael Stadler michael.stadler@fmi.ch) always appreciate receiving reports of bugs in the package functions or in the documentation. The same goes for well-considered suggestions for improvements.
Any other questions or problems concerning QuasR should be posted to the Bioconductor support site (https://support.bioconductor.org). Users posting to the support site for the first time should read the helpful posting guide at (https://support.bioconductor.org/info/faq/). Note that each function in QuasR has it’s own help page, as described in the section @ref(introToR). Posting etiquette requires that you read the relevant help page carefully before posting a problem to the site.
If you already use R and know about its interface, just skip this section and continue with section @ref(sampleQuasRsession).
The structure of this vignette and in particular this section is based on the excellent user guide of the limma package, which we would like to hereby acknowledge. R is a program for statistical computing. It is a command-driven language meaning that you have to type commands into it rather than pointing and clicking using a mouse. In this guide it will be assumed that you have successfully downloaded and installed R from (http://www.r-project.org) as well as QuasR (see section @ref(installation)). A good way to get started is to type
at the R prompt or, if you’re using R for Windows, to follow the drop-down menu items Help \(\succ\) Html help. Following the links Packages \(\succ\) QuasR from the html help page will lead you to the contents page of help topics for functions in QuasR.
Before you can use any QuasR commands you have to load the package by typing
at the R prompt. You can get help on any function in
any loaded package by typing ? and the function name at the
R prompt, for example
or equivalently
for detailed help on the preprocessReads function. The
function help page is especially useful to learn about its arguments and
its return value.
Working with R usually means creating and transforming objects. Objects might include data sets, variables, functions, anything at all. For example
will create a variable x and will assign it the value 2.
At any stage of your R session you can type
to get a list of all the objects currently existing in your session.
You can display an object by typing its name on the prompt. The
following displays the object x:
We hope that you can use QuasR without having to spend a lot of time learning about the R language itself but a little knowledge in this direction will be very helpful, especially when you want to do something not explicitly provided for in QuasR or in the other Bioconductor packages. For more details about the R language see An Introduction to R which is available from the online help, or one of the many great online resources, like the documentation at r-project.org, the growing list of free books at bioconductor.org, or the books from rstudio.com (many of which are also available for free). For more background on using R for statistical analysis see (Dalgaard 2002).
This is a quick overview of what an analysis could look like for
users preferring to jump right into an analysis. The example uses data
that is provided with the QuasR
package, which is first copied to the current working directory, into a
subfolder called "extdata":
## [1] TRUE
The sequence files to be analyzed are listed in
sampleFile (see section @ref(sampleFile) for details). The
sequence reads will be aligned using bowtie (Langmead et al. 2009) (from the Rbowtie
package (Hahne, Lerch, and Stadler 2012))
to a small reference genome (consisting of three short segments from the
hg19 human genome assembly, available in full for example in the BSgenome.Hsapiens.UCSC.hg19
package). Information on selecting an appropriate reference genome is
summarized in section @ref(genome).
Make sure that you have sufficient disk space, both in your
R temporary directory (tempdir()) as well
as to store the resulting alignments (see section @ref(qAlign)).
sampleFile <- "extdata/samples_chip_single.txt"
genomeFile <- "extdata/hg19sub.fa"
proj <- qAlign(sampleFile, genomeFile)## Creating .fai file for: /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub.fa
## alignment files missing - need to:
## create alignment index for the genome
## create 2 genomic alignment(s)
## Creating an Rbowtie index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub.fa
## Finished creating index
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## ddab87c07814: 1
## Performing genomic alignments for 2 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff56b7ff7af.txt
## Genomic alignments have been created successfully
## Project: qProject
## Options : maxHits : 1
## paired : no
## splicedAlignment: FALSE
## bisulfite : no
## snpFile : none
## geneAnnotation : none
## Aligner : Rbowtie v1.51.0 (parameters: -m 1 --best --strata)
## Genome : /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignet.../hg19sub.fa (file)
##
## Reads : 2 files, 2 samples (fastq format):
## 1. chip_1_1.fq.bz2 Sample1 (phred33)
## 2. chip_2_1.fq.bz2 Sample2 (phred33)
##
## Genome alignments: directory: same as reads
## 1. chip_1_1_1ff570ec201.bam
## 2. chip_2_1_1ff5b126fd3.bam
##
## Aux. alignments: none
The proj object keeps track of all the information of a
sequencing experiment, for example where sequence and alignment files
are stored, and what aligner and reference genome was used to generate
the alignments.
Now that the alignments have been generated, further analyses can be
performed. A quality control report is saved to the
"extdata/qc_report.pdf" file using the
qQCReport function.
## collecting quality control data
## creating QC plots
The number of alignments per promoter region is quantified using
qCount. Genomic coordinates for promoter regions are
imported from a gtf file (annotFile) into the
GRanges-object with the name promReg:
library(rtracklayer)
library(GenomicFeatures)
annotFile <- "extdata/hg19sub_annotation.gtf"
txStart <- import.gff(annotFile, format = "gtf", feature.type = "start_codon")
promReg <- promoters(txStart, upstream = 500, downstream = 500)
names(promReg) <- mcols(promReg)$transcript_name
promCounts <- qCount(proj, query = promReg)## counting alignments...done
## width Sample1 Sample2
## TNFRSF18-003 1000 20 4
## TNFRSF18-002 1000 20 4
## TNFRSF18-001 1000 20 4
## TNFRSF4-001 1000 5 2
## SDF4-007 1000 8 2
## SDF4-001 1000 8 2
## SDF4-002 1000 8 2
## SDF4-201 1000 8 2
## B3GALT6-001 1000 25 274
## RPS7-001 1000 121 731
## RPS7-008 1000 121 731
## RPS7-009 1000 121 731
## RPS7-005 1000 121 731
## C3orf10-201 1000 176 496
## C3orf10-001 1000 176 496
## AC034193.1-201 1000 5 2
## VHL-001 1000 61 336
## VHL-002 1000 61 336
## VHL-201 1000 61 336
The following scheme shows the major components of QuasR and
their relationships:
QuasR works with data (sequences and alignments, reference genome, etc.) that are stored as files on your storage (the gray cylinder on the lower left of Figure above, see section @ref(fileStorageLocations) for details on storage locations). QuasR does not need a database management system, or these files to be named and organized according to a specific scheme.
In order to keep track of directory paths during an analysis, QuasR makes
use of a qProject object that is returned by the
qAlign function, which at the minimum requires two inputs:
the name of a samples text file (see section @ref(sampleFile) for
details), and the reference genome for the alignments (see section
@ref(genome)).
The qProject object is the main argument passed to
subsequent functions such as qQCReport and
qCount. The qProject object contains all
necessary information on the current project and eliminates the need to
repeatedly enter the same information. All functions that work on
qProject objects can be recognized by their names starting
with the letter q.
Read quantification (apart from quantification of methylation which
has its own function qMeth) is done using the
qCount function: It counts the alignments in regions of
interest (e.g. promoters, genes, exons, etc.) and produces a count table
(regions in rows, samples in columns) for further visualization and
analysis. The count table can also be used as input to a statistical
analysis using packages such as edgeR (Robinson, McCarthy, and Smyth 2010), DESeq (Anders and Huber 2010), DESeq2
(Love, Huber, and Anders 2014), TCC (Sun et al. 2013), DEXSeq
(Anders, Reyes, and Huber 2012) or baySeq
(Hardcastle and Kelly 2010).
In summary, a typical QuasR analysis consists of the following steps (some of them are optional):
preprocessReads (optional): Remove adapters from start
or end of reads, filter out reads of low quality, short length or low
complexity (section @ref(preProcessing)).qAlign: Create qProject object and specify
project parameters. Also download BSgenome package, create aligner
indices and align reads if not already existing (section
@ref(qAlign)).qQCReport (optional): Create quality control report
with plots on sequence qualities and alignment statistics (section
@ref(qQCReport)).qExportWig (optional): Export genomic alignments as
wiggle tracks for genome browser visualization (section
@ref(qExportWig)).qCount: Quantify alignments in regions of interest
(section @ref(qCount)).Recurrent example tasks that may be part of any typical analysis are described in section @ref(exampleTasks). Example workflows for specific experiment types (ChIP-seq, RNA-seq and Bis-seq) are described in section @ref(exampleWorkflows).
Apart from qExportWig and qQCReport, which
generate wig files and pdf reports, qAlign is the only
function in QuasR that
stores files on the disk (see section @ref(qAlign) for details). All
files generated by qAlign are listed here by type, together
with their default location and how locations can be changed.
tempdir()):
Temporary files include reference genomes in fasta format,
decompressed input sequence files, and temporary alignments in text
format, and can require a large amount of disk space. By default, these
files will be written to the temporary directory of the
R process (as reported by tempdir()). If
using clObj for parallel processing, this may be the
tempdir() from the cluster node(s). An alternative location
can be set using the TMPDIR environment variable (see
?tempdir).bam format) (default: same
directory as the input sequence files): Alignments against reference
genome and auxiliary targets are stored in bam format in
the same directory that also contains the input sequence file (listed in
sampleFile). Please note that if the input sequence file
corresponds to a symbolic link, QuasR will
follow the link and use the directory of the original file instead. An
alternative directory can be specified with the
alignmentsDir argument from qAlign, which will
store all bam files in that directory even if the input
sequence files are located in different directories.genome and snpFile arguments): Many alignment
tools including bowtie require an index of the reference
sequence to perform alignments. If necessary, qAlign will
build this index automatically and store it in a default location that
depends on the genome argument:
BSgenome: If genome is the name of a
BSgenome
package (such as "BSgenome.Hsapiens.UCSC.hg19"), the index
will be stored as a new R package in the default
library path (as reported by .libPaths()[1], see
?install.packages for details), or alternatively in the
library specified by the lib.loc argument of
qAlign. The name of this index package will be the name of
the original BSgenome
package with a suffix for the index type, for example
"BSgenome.Hsapiens.UCSC.hg19.Rbowtie".fasta: If genome refers to a reference
genome file in fasta format, the index will be stored in a
subdirectory at the same location. Similarly, the indices for files
listed in auxiliaryFile are store at the location of these
files. For example, the Rbowtie index for the genome at
"./genome/mm9.fa" is stored in
"./genome/mm9.fa.Rbowtie".snpFile (e.g. "./mySNPs.tab") are injected
into the genome
(e.g. "BSgenome.Mmusculus.UCSC.mm9") to create two variant
genomes to be indexed. These indices are saved at the location of the
snpFile in a directory named after snpFile,
genome and the index type
(e.g. "./mySNPs.tab.BSgenome.Mmusculus.UCSC.mm9.A.fa.Rbowtie").The sample file is a tab-delimited text file with two or three columns. The first row contains the column names: For a single read experiment, these are ‘FileName’ and ‘SampleName’; for a paired-end experiment, these are ‘FileName1’, ‘FileName2’ and ‘SampleName’. If the first row does not contain the correctly spelled column names, QuasR will not accept the samples file. Subsequent rows contain the input sequence files.
Here are examples of such sample files for a single read experiment:
FileName SampleName chip_1_1.fq.bz2 Sample1 chip_2_1.fq.bz2 Sample2
and for a paired-end experiment:
FileName1 FileName2 SampleName rna_1_1.fq.bz2 rna_1_2.fq.bz2 Sample1 rna_2_1.fq.bz2 rna_2_2.fq.bz2 Sample2
These example files are also contained in the QuasR package and may be used as templates. The path of the files can be determined using:
sampleFile1 <- system.file(package="QuasR", "extdata",
"samples_chip_single.txt")
sampleFile2 <- system.file(package="QuasR", "extdata",
"samples_rna_paired.txt")The columns FileName for single-read, or FileName1
and FileName2 for paired-end experiments contain paths and
names to files containing the sequence data. The paths can be absolute
or relative to the location of the sample file. This allows combining
files from different directories in a single analysis. For each input
sequence file, qAlign will create one alignment file and by
default store it in the same directory as the sequence file. Already
existing alignment files with identical parameters will not be
re-created, so that it is easy to reuse the same sequence files in
multiple projects without unnecessarily copying sequence files or
recreating alignments.
The SampleName column contains sample names for each
sequence file. The same name can be used on several lines to indicate
multiple sequence files that belong to the same sample
(qCount can use this information to automatically combine
counts for one sample from multiple files).
Three file formats are supported for input files (but cannot be mixed within a single sample file):
bam files. This makes it possible to use alignment
tools that are not available within QuasR, but
making use of this option comes with a risk and should only be used by
experienced users. For example, it cannot be guaranteed any more that
certain assumptions made by qCount are fulfilled by the
external aligner (see below). When using external bam
files, we recommend to use files which contain only one alignment per
read. This may also include multi-hit reads, for which one of the
alignments is randomly selected. This allows QuasR to
count the total number of reads by counting the total number of
alignments. Furthermore, if the bam files also contain the
unmapped reads, QuasR will
be able to calculate the fraction of mapped reads. For bisulfite samples
we require ungapped alignments stored in unpaired or paired ff
orientation (even if the input reads are fr). For
allele-specific bam files, QuasR
requires an additional tag for each alignment called XV of
type A (printable character) with the possible values
R (Reference), U (Unknown) and A
(Alternative).fasta and fastq files can be compressed with gzip, bzip2 or xz (file extensions ‘.gz’, ‘.bz2’ or ‘xz’, respectively) and will be automatically decompressed when necessary.
bam files after performing
alignmentsOnce alignments have been created, most analyses will only require
the bam files and will not access the original raw sequence
files anymore. However, re-creating a qProject object by a
later identical call to qAlign will still need access to
the raw sequences to verify consistency between raw data and alignments.
It may be desirable to remove this dependency, for example to archive or
move away the raw sequence files and to reclaim used disk space.
This can be achieved using the following procedure involving two
sequential calls to qAlign. First, qAlign is
called with the orignial sample file (sampleFile1) that
lists the raw sequence files, and subsequently with a second sample file
(sampleFile2) that lists the bam files
generated in the first call. Such a second sample file can be easily
generated given the qProject object (proj1)
returned by the first call:
sampleFile1 <- "samples_fastq.txt"
sampleFile2 <- "samples_bam.txt"
proj1 <- qAlign(sampleFile1, genomeFile)
write.table(alignments(proj1)$genome, sampleFile2, sep="\t", row.names=FALSE)
proj2 <- qAlign(sampleFile2, genomeFile)The analysis can now be exclusively based on the bam
files using sampleFile2 and proj2.
The sample file implicitly defines the type of samples contained in
the project: single read or paired-end read, sequences
with or without qualities. This type will have a
profound impact on the downstream analysis. For example, it controls
whether alignments will be performed in single or paired-end mode,
either with or without base qualities. That will also determine
availability of certain options for quality control and quantification
in qQCReport and qCount. For consistency, it
is therefore required that all samples within a project have the same
type; it is not possible to mix both single and paired-end read samples,
or fasta and fastq files in a single
project (sample file). If necessary, it may be possible to analyse
different types of files in separate QuasR
projects and combine the derived results at the end.
By default QuasR
aligns reads only to the reference genome. However, it may be
interesting to align non-matching reads to further targets, for example
to identify contamination from vectors or a different species, or in
order to quantify spike-in material not contained in the reference
genome. In QuasR, such
supplementary reference files are called auxiliary references
and can be specified to qAlign using the
auxiliaryFile argument (see section @ref(qAlign) for
details). The format of the auxiliary file is similar to the one of the
sample file described in section @ref(sampleFile): It contains two
columns with column names ‘FileName’ and ‘AuxName’ in the first row.
Additional rows contain names and files of one or several auxiliary
references in fasta format.
An example auxiliary file looks like this:
FileName AuxName NC_001422.1.fa phiX174
and is available from your QuasR installation at
Sequence reads are primarily aligned against the reference genome (see section @ref(redundancy) on how to choose a suitable reference assembly). If necessary, QuasR will create an aligner index for the genome. The reference genome can be provided in one of two different formats:
## [1] "BSgenome.Alyrata.JGI.v1"
## [2] "BSgenome.Amellifera.BeeBase.assembly4"
## [3] "BSgenome.Amellifera.NCBI.AmelHAv3.1"
## [4] "BSgenome.Amellifera.UCSC.apiMel2"
## [5] "BSgenome.Amellifera.UCSC.apiMel2.masked"
## [6] "BSgenome.Aofficinalis.NCBI.V1"
## [7] "BSgenome.Athaliana.TAIR.04232008"
## [8] "BSgenome.Athaliana.TAIR.TAIR9"
## [9] "BSgenome.Btaurus.UCSC.bosTau3"
## [10] "BSgenome.Btaurus.UCSC.bosTau3.masked"
## [11] "BSgenome.Btaurus.UCSC.bosTau4"
## [12] "BSgenome.Btaurus.UCSC.bosTau4.masked"
## [13] "BSgenome.Btaurus.UCSC.bosTau6"
## [14] "BSgenome.Btaurus.UCSC.bosTau6.masked"
## [15] "BSgenome.Btaurus.UCSC.bosTau8"
## [16] "BSgenome.Btaurus.UCSC.bosTau9"
## [17] "BSgenome.Btaurus.UCSC.bosTau9.masked"
## [18] "BSgenome.Carietinum.NCBI.v1"
## [19] "BSgenome.Celegans.UCSC.ce10"
## [20] "BSgenome.Celegans.UCSC.ce11"
## [21] "BSgenome.Celegans.UCSC.ce2"
## [22] "BSgenome.Celegans.UCSC.ce6"
## [23] "BSgenome.Cfamiliaris.UCSC.canFam2"
## [24] "BSgenome.Cfamiliaris.UCSC.canFam2.masked"
## [25] "BSgenome.Cfamiliaris.UCSC.canFam3"
## [26] "BSgenome.Cfamiliaris.UCSC.canFam3.masked"
## [27] "BSgenome.Cjacchus.UCSC.calJac3"
## [28] "BSgenome.Cjacchus.UCSC.calJac4"
## [29] "BSgenome.CneoformansVarGrubiiKN99.NCBI.ASM221672v1"
## [30] "BSgenome.Creinhardtii.JGI.v5.6"
## [31] "BSgenome.Dmelanogaster.UCSC.dm2"
## [32] "BSgenome.Dmelanogaster.UCSC.dm2.masked"
## [33] "BSgenome.Dmelanogaster.UCSC.dm3"
## [34] "BSgenome.Dmelanogaster.UCSC.dm3.masked"
## [35] "BSgenome.Dmelanogaster.UCSC.dm6"
## [36] "BSgenome.Drerio.UCSC.danRer10"
## [37] "BSgenome.Drerio.UCSC.danRer11"
## [38] "BSgenome.Drerio.UCSC.danRer5"
## [39] "BSgenome.Drerio.UCSC.danRer5.masked"
## [40] "BSgenome.Drerio.UCSC.danRer6"
## [41] "BSgenome.Drerio.UCSC.danRer6.masked"
## [42] "BSgenome.Drerio.UCSC.danRer7"
## [43] "BSgenome.Drerio.UCSC.danRer7.masked"
## [44] "BSgenome.Dvirilis.Ensembl.dvircaf1"
## [45] "BSgenome.Ecoli.NCBI.20080805"
## [46] "BSgenome.Gaculeatus.UCSC.gasAcu1"
## [47] "BSgenome.Gaculeatus.UCSC.gasAcu1.masked"
## [48] "BSgenome.Ggallus.UCSC.galGal3"
## [49] "BSgenome.Ggallus.UCSC.galGal3.masked"
## [50] "BSgenome.Ggallus.UCSC.galGal4"
## [51] "BSgenome.Ggallus.UCSC.galGal4.masked"
## [52] "BSgenome.Ggallus.UCSC.galGal5"
## [53] "BSgenome.Ggallus.UCSC.galGal6"
## [54] "BSgenome.Gmax.NCBI.Gmv40"
## [55] "BSgenome.Hsapiens.1000genomes.hs37d5"
## [56] "BSgenome.Hsapiens.NCBI.GRCh38"
## [57] "BSgenome.Hsapiens.NCBI.T2T.CHM13v2.0"
## [58] "BSgenome.Hsapiens.UCSC.hg17"
## [59] "BSgenome.Hsapiens.UCSC.hg17.masked"
## [60] "BSgenome.Hsapiens.UCSC.hg18"
## [61] "BSgenome.Hsapiens.UCSC.hg18.masked"
## [62] "BSgenome.Hsapiens.UCSC.hg19"
## [63] "BSgenome.Hsapiens.UCSC.hg19.masked"
## [64] "BSgenome.Hsapiens.UCSC.hg38"
## [65] "BSgenome.Hsapiens.UCSC.hg38.dbSNP151.major"
## [66] "BSgenome.Hsapiens.UCSC.hg38.dbSNP151.minor"
## [67] "BSgenome.Hsapiens.UCSC.hg38.masked"
## [68] "BSgenome.Hsapiens.UCSC.hs1"
## [69] "BSgenome.Mdomestica.UCSC.monDom5"
## [70] "BSgenome.Mfascicularis.NCBI.5.0"
## [71] "BSgenome.Mfascicularis.NCBI.6.0"
## [72] "BSgenome.Mfuro.UCSC.musFur1"
## [73] "BSgenome.Mmulatta.UCSC.rheMac10"
## [74] "BSgenome.Mmulatta.UCSC.rheMac2"
## [75] "BSgenome.Mmulatta.UCSC.rheMac2.masked"
## [76] "BSgenome.Mmulatta.UCSC.rheMac3"
## [77] "BSgenome.Mmulatta.UCSC.rheMac3.masked"
## [78] "BSgenome.Mmulatta.UCSC.rheMac8"
## [79] "BSgenome.Mmusculus.UCSC.mm10"
## [80] "BSgenome.Mmusculus.UCSC.mm10.masked"
## [81] "BSgenome.Mmusculus.UCSC.mm39"
## [82] "BSgenome.Mmusculus.UCSC.mm8"
## [83] "BSgenome.Mmusculus.UCSC.mm8.masked"
## [84] "BSgenome.Mmusculus.UCSC.mm9"
## [85] "BSgenome.Mmusculus.UCSC.mm9.masked"
## [86] "BSgenome.Osativa.MSU.MSU7"
## [87] "BSgenome.Ppaniscus.UCSC.panPan1"
## [88] "BSgenome.Ppaniscus.UCSC.panPan2"
## [89] "BSgenome.Ptroglodytes.UCSC.panTro2"
## [90] "BSgenome.Ptroglodytes.UCSC.panTro2.masked"
## [91] "BSgenome.Ptroglodytes.UCSC.panTro3"
## [92] "BSgenome.Ptroglodytes.UCSC.panTro3.masked"
## [93] "BSgenome.Ptroglodytes.UCSC.panTro5"
## [94] "BSgenome.Ptroglodytes.UCSC.panTro6"
## [95] "BSgenome.Rnorvegicus.UCSC.rn4"
## [96] "BSgenome.Rnorvegicus.UCSC.rn4.masked"
## [97] "BSgenome.Rnorvegicus.UCSC.rn5"
## [98] "BSgenome.Rnorvegicus.UCSC.rn5.masked"
## [99] "BSgenome.Rnorvegicus.UCSC.rn6"
## [100] "BSgenome.Rnorvegicus.UCSC.rn7"
## [101] "BSgenome.Scerevisiae.UCSC.sacCer1"
## [102] "BSgenome.Scerevisiae.UCSC.sacCer2"
## [103] "BSgenome.Scerevisiae.UCSC.sacCer3"
## [104] "BSgenome.Sscrofa.UCSC.susScr11"
## [105] "BSgenome.Sscrofa.UCSC.susScr3"
## [106] "BSgenome.Sscrofa.UCSC.susScr3.masked"
## [107] "BSgenome.Tgondii.ToxoDB.7.0"
## [108] "BSgenome.Tguttata.UCSC.taeGut1"
## [109] "BSgenome.Tguttata.UCSC.taeGut1.masked"
## [110] "BSgenome.Tguttata.UCSC.taeGut2"
## [111] "BSgenome.Vvinifera.URGI.IGGP12Xv0"
## [112] "BSgenome.Vvinifera.URGI.IGGP12Xv2"
## [113] "BSgenome.Vvinifera.URGI.IGGP8X"
In this example, the BSgenome package
"BSgenome.Hsapiens.UCSC.hg19" refers to an unmasked genome;
alignment index and alignments will be performed on the full unmasked
genome sequence (recommended). If using a masked genome
(e.g. "BSgenome.Hsapiens.UCSC.hg19.masked"), masked regions
will be replaced with "N" bases, and this hard-masked
version of the genome will be used for creating the alignment index and
further alignments. Please also see section @ref(redundancy) for
potential issues with redundant sequences contained in the reference
genome, e.g. in BSgenome.Hsapiens.UCSC.hg19
or BSgenome.Hsapiens.UCSC.hg38.
fasta format:For some organisms, several versions of the genome assembly exist. These differ for example in whether or not they include alternative variants for sequences that are variable within the species. This may lead to redundant sequences in the assembly, and thus reads mapping to such sequences being wrongly classified as “multi-mapping”, and comparing data aligned to different assembly version may give rise to incorrect results. A nice summary of this issue is provided in this blog post from Heng Li.
The BSgenome packages BSgenome.Hsapiens.UCSC.hg19 (versions newer than 1.4.0 from Bioconductor 3.10) and BSgenome.Hsapiens.UCSC.hg38 (all versions) do contain such redundant sequences and are therefore not ideal references for alignment of human data. Specific “analysis set” or “primary assembly” versions of the assembly should be used instead (see the before-mentioned blog post for details).
When using a BSgenome
reference, QuasR will
check in the qAlign function whether the chromosome names
and lengths contained in the header of any pre-existing bam files are
identical to the ones provided by the genome and warn if this is not the
case.
The preprocessReads function can be used to prepare the
input sequence files prior to alignment. The function takes one or
several sequence files (or pairs of files for a paired-end experiment)
in fasta or fastq format as input and produces
the same number of output files with the processed reads.
In the following example, we truncate the reads by removing the three
bases from the 3’-end (the right side), remove the adapter sequence
AAAAAAAAAA from the 5’-end (the left side) and filter out
reads that, after truncation and adapter removal, are shorter than 14
bases or contain more than 2 N bases:
td <- tempdir()
infiles <- system.file(package = "QuasR", "extdata",
c("rna_1_1.fq.bz2","rna_2_1.fq.bz2"))
outfiles <- file.path(td, basename(infiles))
res <- preprocessReads(filename = infiles,
outputFilename = outfiles,
truncateEndBases = 3,
Lpattern = "AAAAAAAAAA",
minLength = 14,
nBases = 2)## filtering /tmp/RtmpjnpgPc/Rinst1ba3698279be/QuasR/extdata/rna_1_1.fq.bz2
## filtering /tmp/RtmpjnpgPc/Rinst1ba3698279be/QuasR/extdata/rna_2_1.fq.bz2
## rna_1_1.fq.bz2 rna_2_1.fq.bz2
## totalSequences 3002 3000
## matchTo5pAdapter 466 463
## matchTo3pAdapter 0 0
## tooShort 107 91
## tooManyN 0 0
## lowComplexity 0 0
## totalPassed 2895 2909
preprocessReads returns a matrix with a summary of the
pre-processing. The matrix contains one column per (pair of) input
sequence files, and contains the total number of reads
(totalSequences), the number of reads that matched to the
five prime or three prime adapters (matchTo5pAdapter and
matchTo3pAdapter), the number of reads that were too short
(tooShort), contained too many non-base characters
(tooManyN) or were of low sequence complexity
(lowComplexity, deactivated by default). Finally, the
number of reads that passed the filtering steps is reported in the last
row (totalPassed).
In the example below we process paired-end reads, removing all pairs
with one or several N bases. Even if only one sequence in a
pair fulfills the filtering criteria, both reads in the pair are
removed, thereby preserving the matching order of the sequences in the
two files:
td <- tempdir()
infiles1 <- system.file(package = "QuasR", "extdata", "rna_1_1.fq.bz2")
infiles2 <- system.file(package = "QuasR", "extdata", "rna_1_2.fq.bz2")
outfiles1 <- file.path(td, basename(infiles1))
outfiles2 <- file.path(td, basename(infiles2))
res <- preprocessReads(filename = infiles1,
filenameMate = infiles2,
outputFilename = outfiles1,
outputFilenameMate = outfiles2,
nBases = 0)## filtering /tmp/RtmpjnpgPc/Rinst1ba3698279be/QuasR/extdata/rna_1_1.fq.bz2 and
## /tmp/RtmpjnpgPc/Rinst1ba3698279be/QuasR/extdata/rna_1_2.fq.bz2
## rna_1_1.fq.bz2:rna_1_2.fq.bz2
## totalSequences 3002
## matchTo5pAdapter NA
## matchTo3pAdapter NA
## tooShort 0
## tooManyN 3
## lowComplexity 0
## totalPassed 2999
More details on the preprocessReads function can be
found in the function documentation (see ?preprocessReads)
or in the section @ref(preprocessReads).
Here we show an exemplary single-end ChIP-seq workflow using a small
number of reads from a histone 3 lysine 4 trimethyl (H3K4me3) ChIP-seq
experiment. This histone modification is known to locate to genomic
regions with a high density of CpG dinucleotides (so called CpG
islands); about 60% of mammalian genes have such a CpG island close to
their transcript start site. All necessary files are included in the
QuasR
package, and we start the example workflow by copying those files into
the current working directly, into a subfolder called
"extdata":
## [1] TRUE
qAlign functionWe assume that the sequence reads have already been pre-processed as
described in section @ref(preProcessing). Also, a sample file (section
@ref(sampleFile)) that lists all sequence files to be analyzed has been
prepared. A fasta file with the reference genome
sequence(s) is also available (section @ref(genome)), as well as an
auxiliary file for alignment of reads that failed to match the reference
genome (section @ref(auxiliaryFile)).
By default, newly generated bam files will be stored at
the location of the input sequence files, which should be writable and
have sufficient capacity (an alternative location can be specified using
the alignmentsDir argument). Make also sure that you have
sufficient temporary disk space for intermediate files in
tempdir() (see section @ref(qAlign)). We start by aligning
the reads using qAlign:
sampleFile <- "extdata/samples_chip_single.txt"
auxFile <- "extdata/auxiliaries.txt"
genomeFile <- "extdata/hg19sub.fa"
proj1 <- qAlign(sampleFile, genome = genomeFile, auxiliaryFile = auxFile)## alignment files missing - need to:
## create 2 auxiliary alignment(s)
## Creating an Rbowtie index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/NC_001422.1.fa
## Finished creating index
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## nodeNames
## ddab87c07814
## 1
## Performing auxiliary alignments for 2 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff563b62a64.txt
## Auxiliary alignments have been created successfully
## Project: qProject
## Options : maxHits : 1
## paired : no
## splicedAlignment: FALSE
## bisulfite : no
## snpFile : none
## geneAnnotation : none
## Aligner : Rbowtie v1.51.0 (parameters: -m 1 --best --strata)
## Genome : /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignet.../hg19sub.fa (file)
##
## Reads : 2 files, 2 samples (fastq format):
## 1. chip_1_1.fq.bz2 Sample1 (phred33)
## 2. chip_2_1.fq.bz2 Sample2 (phred33)
##
## Genome alignments: directory: same as reads
## 1. chip_1_1_1ff570ec201.bam
## 2. chip_2_1_1ff5b126fd3.bam
##
## Aux. alignments: 1 file, directory: same as reads
## a. /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignett.../NC_001422.1.fa phiX174
## 1. chip_1_1_1ff54dd3613d.bam
## 2. chip_2_1_1ff528cfefc4.bam
qAlign will build alignment indices if they do not yet
exist (by default, if the genome and auxiliary sequences are given in
the form of fasta files, they will be stored in the same
folder). The qProject object (proj1) returned
by qAlign now contains all information about the ChIP-seq
experiment: the (optional) project name, the project options, aligner
package, reference genome, and at the bottom the sequence and alignment
files. For each input sequence file, there will be one bam
file with alignments against the reference genome, and one for each
auxiliary target sequence with alignments of reads without genome hits.
Our auxFile contains a single auxiliary target sequence, so
we expect two bam files per input sequence file:
## [1] "chip_1_1_1ff54dd3613d.bam" "chip_1_1_1ff570ec201.bam"
## [3] "chip_2_1_1ff528cfefc4.bam" "chip_2_1_1ff5b126fd3.bam"
## [5] "phiX_paired_withSecondary.bam"
The bam file names consist of the base name of the
sequence file with an added random string. The random suffix makes sure
that newly generated alignment files do not overwrite existing ones, for
example of the same reads aligned against an alternative reference
genome. Each alignment file is accompanied by two additional files with
suffixes .bai and .txt:
## [1] "chip_1_1_1ff54dd3613d.bam" "chip_1_1_1ff54dd3613d.bam.bai"
## [3] "chip_1_1_1ff54dd3613d.bam.txt"
The .bai file is the bam index used for
fast access by genomic coordinate. The .txt file contains
all the parameters used to generate the corresponding bam
file. Before new alignments are generated, qAlign will look
for available .txt files in default locations (the
directory containing the input sequence file, or the value of
alignmentsDir), and read their contents to determine if a
compatible bam file already exists. A compatible
bam file is one with the same reads and genome, aligned
using the same aligner and identical alignment parameters. If a
compatible bam file is not found, or the .txt
file is missing, qAlign will generate a new
bam file. It is therefore recommended not to delete the
.txt file - without it, the corresponding bam
file will become unusable for QuasR.
QuasR can
produce a quality control report in the form of a series of diagnostic
plots with details on sequences and alignments (see QuasR scheme figure
above). The plots are generated by calling the qQCReport
function with the qProject object as argument.
qQCReport uses ShortRead
(Morgan et al. 2009) internally to obtain
some of the quality metrics, and some of the plots are inspired by the
FastQC quality control tool by Simon Andrews (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/).
The plots will be stored into a multipage PDF document defined by the
pdfFilename argument, or else shown as individual plot
windows on the current graphics device. In order to keep the running
time reasonably short, some quality metrics are obtained from a random
sub-sample of the sequences or alignments.
## collecting quality control data
## creating QC plots
## collecting quality control data
## creating QC plots
Currently available plots are described in section @ref(qQCReport) and following.
The alignmentStats gets the number of (un-)mapped reads
for each sequence file in a qProject object, by reading the
bam file indices, and returns them as a
data.frame. The function also works for arguments of type
character with one or several bam file names
(for details see section @ref(alignmentStats)).
## seqlength mapped unmapped
## Sample1:genome 95000 2339 258
## Sample2:genome 95000 3609 505
## Sample1:phiX174 5386 251 7
## Sample2:phiX174 5386 493 12
For visualization in a genome browser, alignment coverage along the
genome can be exported to a (compressed) wig file using the
qExportWig function. The created fixedStep wig file (see
(http://genome.ucsc.edu/goldenPath/help/wiggle.html) for
details on the wig format) will contain one track per sample in the
qProject object. The resolution is defined using the
binsize argument, and if scaling is set to
TRUE, read counts per bin are scaled by the total number of
aligned reads in each sample to improve comparability:
## collecting mapping statistics for scaling...done
## start creating wig files...
## Sample1.wig.gz (Sample1)
## Sample2.wig.gz (Sample2)
## done
qCountAlignments are quantified using qCount, for example
using a GRanges object as a query. In our H3K4me3 ChIP-seq
example, we expect the reads to occur around the transcript start site
of genes. We can therefore construct suitable query regions using
genomic intervals around the start sites of known genes. In the code
below, this is achieved with help from the txdbmaker
package to first create a TxDb object from a
.gtf file with gene annotation. With the
promoters function from the GenomicFeatures
package, we can then create the GRanges object with regions
to be quantified. Finally, because most genes consist of multiple
overlapping transcripts, we select the first transcript for each
gene:
library(txdbmaker)
annotFile <- "extdata/hg19sub_annotation.gtf"
chrLen <- scanFaIndex(genomeFile)
chrominfo <- data.frame(chrom = as.character(seqnames(chrLen)),
length = width(chrLen),
is_circular = rep(FALSE, length(chrLen)))
txdb <- makeTxDbFromGFF(file = annotFile, format = "gtf",
chrominfo = chrominfo,
dataSource = "Ensembl",
organism = "Homo sapiens")## Import genomic features from the file as a GRanges object ... OK
## Prepare the 'metadata' data frame ... OK
## Make the TxDb object ...
## Warning in .makeTxDb_normarg_chrominfo(chrominfo): genome version information
## is not available for this TxDb object
## OK
promReg <- promoters(txdb, upstream = 1000, downstream = 500,
columns = c("gene_id","tx_id"))
gnId <- vapply(mcols(promReg)$gene_id,
FUN = paste, FUN.VALUE = "",
collapse = ",")
promRegSel <- promReg[ match(unique(gnId), gnId) ]
names(promRegSel) <- unique(gnId)
promRegSel## GRanges object with 12 ranges and 2 metadata columns:
## seqnames ranges strand | gene_id tx_id
## <Rle> <IRanges> <Rle> | <CharacterList> <integer>
## ENSG00000176022 chr1 31629-33128 + | ENSG00000176022 1
## ENSG00000186891 chr1 6452-7951 - | ENSG00000186891 2
## ENSG00000186827 chr1 14013-15512 - | ENSG00000186827 6
## ENSG00000078808 chr1 31882-33381 - | ENSG00000078808 9
## ENSG00000171863 chr2 1795-3294 + | ENSG00000171863 17
## ... ... ... ... . ... ...
## ENSG00000254999 chr3 1276-2775 + | ENSG00000254999 28
## ENSG00000238642 chr3 19069-20568 + | ENSG00000238642 30
## ENSG00000134086 chr3 26692-28191 + | ENSG00000134086 31
## ENSG00000238345 chr3 26834-28333 + | ENSG00000238345 32
## ENSG00000134075 chr3 13102-14601 - | ENSG00000134075 36
## -------
## seqinfo: 3 sequences from an unspecified genome
Using promRegSel object as query, we can now count the
alignment per sample in each of the promoter windows.
## counting alignments...done
## width Sample1 Sample2
## ENSG00000176022 1500 157 701
## ENSG00000186891 1500 22 5
## ENSG00000186827 1500 10 3
## ENSG00000078808 1500 73 558
## ENSG00000171863 1500 94 339
## ENSG00000252531 1500 59 9
## ENSG00000247886 1500 172 971
## ENSG00000254999 1500 137 389
## ENSG00000238642 1500 8 3
## ENSG00000134086 1500 9 18
## ENSG00000238345 1500 13 25
## ENSG00000134075 1500 7 3
The counts returned by qCount are the raw number of
alignments per sample and region, without any normalization for the
query region length, or the total number of aligned reads in a sample.
As expected, we can find H3K4me3 signal at promoters of a subset of the
genes with CpG island promoters, which we can visualize with help of the
Gviz
package:
## Warning in asMethod(object): NAs introduced by coercion
## Warning in asMethod(object): NAs introduced by coercion
library(Gviz)
axisTrack <- GenomeAxisTrack()
dTrack1 <- DataTrack(range = gr1, name = "Sample 1", type = "h")
dTrack2 <- DataTrack(range = gr2, name = "Sample 2", type = "h")
txTrack <- GeneRegionTrack(txdb, name = "Transcripts", showId = TRUE)
plotTracks(list(axisTrack, dTrack1, dTrack2, txTrack),
chromosome = "chr3", extend.left = 1000)qProfileGiven a set of anchor positions in the genome, qProfile
calculates the number of nearby alignments relative to the anchor
position, for example to generate a average profile. The neighborhood
around anchor positions can be specified by the upstream
and downstream argument. Alignments that are upstream of an
anchor position will have a negative relative position, and downstream
alignments a positive. The anchor positions are all aligned at position
zero in the return value.
Anchor positions will be provided to qProfile using the
query argument, which takes a GRanges object.
The anchor positions correspond to start() for regions on
+ or * strands, and to end() for
regions on the - strand. As mentioned above, we expect
H3K4me3 ChIP-seq alignments to be enriched around the transcript start
site of genes. We can therefore construct a suitable query
object from the start sites of known genes. In the code below, start
sites (start_codon) are imported from a .gtf
file with the help of the rtracklayer
package. In addition, strand and gene_name are
also selected for import. Duplicated start sites, e.g. from genes with
multiple transcripts, are removed. Finally, all regions are given the
name TSS, because qProfile combines regions
with identical names into a single profile.
library(rtracklayer)
annotationFile <- "extdata/hg19sub_annotation.gtf"
tssRegions <- import.gff(annotationFile, format = "gtf",
feature.type = "start_codon",
colnames = "gene_name")
tssRegions <- tssRegions[!duplicated(tssRegions)]
names(tssRegions) <- rep("TSS", length(tssRegions))
head(tssRegions)## GRanges object with 6 ranges and 1 metadata column:
## seqnames ranges strand | gene_name
## <Rle> <IRanges> <Rle> | <character>
## TSS chr1 6949-6951 - | TNFRSF18
## TSS chr1 14505-14507 - | TNFRSF4
## TSS chr1 29171-29173 - | SDF4
## TSS chr1 32659-32661 + | B3GALT6
## TSS chr2 3200-3202 + | RPS7
## TSS chr3 2386-2388 + | C3orf10
## -------
## seqinfo: 3 sequences from an unspecified genome; no seqlengths
Alignments around the tssRegions coordinates are counted
in a window defined by the upstream and
downstream arguments, which specify the number of bases to
include around each anchor position. For query regions on
+ or * strands, upstream refers to the left
side of the anchor position (lower coordinates), while for regions on
the - strand, upstream refers to the right side (higher
coordinates). The following example creates separate profiles for
alignments on the same and on the opposite strand of
the regions in query.
## profiling alignments...done
## profiling alignments...done
## $coverage
## -3000 -2999 -2998 -2997 -2996 -2995 -2994 -2993 -2992 -2991
## 8 8 8 8 8 8 8 8 8 8
##
## $Sample1
## -3000 -2999 -2998 -2997 -2996 -2995 -2994 -2993 -2992 -2991
## 1 0 0 0 0 0 0 0 0 0
##
## $Sample2
## -3000 -2999 -2998 -2997 -2996 -2995 -2994 -2993 -2992 -2991
## 0 0 0 2 0 0 1 1 1 0
The counts returned by qProfile are the raw number of
alignments per sample and position, without any normalization for the
number of query regions or the total number of alignments in a sample
per position. To obtain the average number of alignments, we divide the
alignment counts by the number of query regions that
covered a given relative position around the anchor sites. This coverage
is available as the first element in the return value. The shift between
same and opposite strand alignments is indicative for
the average length of the sequenced ChIP fragments.
prCombS <- do.call("+", prS[-1]) / prS[[1]]
prCombO <- do.call("+", prO[-1]) / prO[[1]]
plot(as.numeric(colnames(prCombS)), filter(prCombS[1,], rep(1/100,100)),
type = 'l', xlab = "Position relative to TSS",
ylab = "Mean no. of alignments")
lines(as.numeric(colnames(prCombO)), filter(prCombO[1,], rep(1/100,100)),
type = 'l', col = "red")
legend(title = "strand", legend = c("same as query","opposite of query"),
x = "topleft", col = c("black","red"),
lwd = 1.5, bty = "n", title.adj = 0.1)QuasR also
allows using of BSgenome
packages instead of a fasta file as reference genome (see
section @ref(genome)). To use a BSgenome,
the genome argument of qAlign is set to a
string matching the name of a BSgenome
package, for example "BSgenome.Hsapiens.UCSC.hg19". If that
package is not already installed, qAlign will abort with an
informative message describing how to install the package using
BiocManager::install. The corresponding alignment index
will be saved as a new package, named after the original BSgenome
package and the aligner used to build the index, for example
BSgenome.Hsapiens.UCSC.hg19.Rbowtie.
The code example below illustrates the use of a BSgenome reference genome for the same example data as above. Running it for the first time will take a few hours in order to build the aligner index, but subsequent uses of the same reference genome will reuse the existing index and immediately start alignments:
file.copy(system.file(package="QuasR", "extdata"), ".", recursive=TRUE)
sampleFile <- "extdata/samples_chip_single.txt"
auxFile <- "extdata/auxiliaries.txt"
available.genomes() # list available genomes
genomeName <- "BSgenome.Hsapiens.UCSC.hg19"
proj1 <- qAlign(sampleFile, genome=genomeName, auxiliaryFile=auxFile)
proj1In QuasR, an
analysis workflow for an RNA-seq dataset is very similar to the one
described above for a ChIP-seq experiment. The major difference is that
here reads are aligned using
qAlign(..., splicedAlignment=TRUE, aligner="Rhisat2"),
which will cause qAlign to align reads with the
HISAT2 aligner (Kim, Langmead, and
Salzberg 2015) (via the Rhisat2
package), rather than with bowtie (Langmead et al. 2009). Before the Rhisat2
package was available (introduced in Bioconductor 3.9),
qAlign(... splicedAlignment=TRUE) aligned reads using
SpliceMap (Au et al. 2010),
which is not recommended now but still possible in order to reproduce
old results. Spliced paired-end alignments are also supported; the
splicedAlignment argument can be freely combined with the
paired argument. In addition, HISAT2 also allows the
specification of known splice sites, which can help in the read
alignment. This is done by specifying the argument
geneAnnotation in qAlign(), to either a
.gtf file or a sqlite database generated by
exporting a TxDb object.
We start the example workflow by copying the example data files into
the current working directly, into a subfolder called
"extdata", and then create spliced alignments using
qAlign:
## [1] TRUE
sampleFile <- "extdata/samples_rna_paired.txt"
genomeFile <- "extdata/hg19sub.fa"
proj2 <- qAlign(sampleFile, genome = genomeFile,
splicedAlignment = TRUE, aligner = "Rhisat2")## alignment files missing - need to:
## create alignment index for the genome
## create 2 genomic alignment(s)
## Creating an Rhisat2 index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub.fa
## Finished creating index
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## ddab87c07814: 1
## Performing genomic alignments for 2 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff52bc358df.txt
## Genomic alignments have been created successfully
## Project: qProject
## Options : maxHits : 1
## paired : fr
## splicedAlignment: TRUE
## bisulfite : no
## snpFile : none
## geneAnnotation : none
## Aligner : Rhisat2 v1.27.0 (parameters: -k 2)
## Genome : /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignet.../hg19sub.fa (file)
##
## Reads : 2 pairs of files, 2 samples (fastq format):
## 1. rna_1_1.fq.bz2 rna_1_2.fq.bz2 Sample1 (phred33)
## 2. rna_2_1.fq.bz2 rna_2_2.fq.bz2 Sample2 (phred33)
##
## Genome alignments: directory: same as reads
## 1. rna_1_1_1ff561b4d216.bam
## 2. rna_2_1_1ff56d38abd9.bam
##
## Aux. alignments: none
Aligning the reads with splicedAlignment=TRUE will allow
to also align reads that cross exon junctions, and thus have a large
deletion (the intron) relative to the reference genome.
## alignment files missing - need to:
## create 2 genomic alignment(s)
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## ddab87c07814: 1
## Performing genomic alignments for 2 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff52310ccc6.txt
## Genomic alignments have been created successfully
## seqlength mapped unmapped
## Sample1:genome 95000 5998 6
## Sample2:genome 95000 5998 2
## seqlength mapped unmapped
## Sample1:genome 95000 2258 3746
## Sample2:genome 95000 2652 3348
As with ChIP-seq experiments, qCount is used to quantify
alignments. For quantification of gene or exon expression levels,
qCount can be called with a query of type
TxDb, such as the one we constructed in the ChIP-seq
workflow above from a .gtf file. The argument
reportLevel can be used to control if annotated exonic
regions should be quantified independently
(reportLevel="exon") or non-redundantly combined per gene
(reportLevel="gene"):
## extracting gene regions from TxDb...done
## counting alignments...done
## collapsing counts by query name...done
## extracting exon regions from TxDb...done
## counting alignments...done
## width Sample1 Sample2
## ENSG00000078808 4697 710 1083
## ENSG00000134075 589 1173 1303
## ENSG00000134086 4213 279 295
## ENSG00000171863 5583 2924 2224
## ENSG00000176022 2793 62 344
## ENSG00000186827 1721 37 8
## width Sample1 Sample2
## 1 2793 62 344
## 10 187 3 0
## 11 307 3 0
## 12 300 11 2
## 13 493 19 2
## 14 129 7 0
The values returned by qCount are the number of
alignments. Sometimes it is required to normalize for the length of
query regions, or the size of the libraries. For example, gene
expression levels in the form of RPKM values (reads per
kilobase of transcript and million mapped reads) can be obtained as
follows:
## Sample1 Sample2
## ENSG00000078808 21350 31786
## ENSG00000134075 281287 304966
## ENSG00000134086 9354 9653
## ENSG00000171863 73974 54915
## ENSG00000176022 3135 16979
## ENSG00000186827 3037 641
## ENSG00000186891 2681 201
## ENSG00000238345 0 0
## ENSG00000238642 0 0
## ENSG00000247886 0 0
## ENSG00000252531 6066 1691
## ENSG00000254999 213296 222826
Please note the RPKM values in our example are higher than what you would usually get for a real RNA-seq dataset. The values here are artificially scaled up because our example data contains reads only for a small number of genes.
Exon-exon junctions can be quantified by setting
reportLevel="junction". In this case, qCount
will ignore the query argument and scan all alignments for
any detected splices, which are returned as a GRanges
object: The region start and end coordinates correspond to the first and
last bases of the intron, and the counts are returned in the
mcols() of the GRanges object. Alignments that
are identically spliced but reside on opposite strands will be
quantified separately. In an unstranded RNA-seq experiment, this may
give rise to two separate counts for the same intron, one each for the
supporting alignments on plus and minus strands.
## counting junctions...done
## GRanges object with 46 ranges and 2 metadata columns:
## seqnames ranges strand | Sample1 Sample2
## <Rle> <IRanges> <Rle> | <numeric> <numeric>
## [1] chr1 12213-12321 + | 3 0
## [2] chr1 13085-13371 - | 1 0
## [3] chr1 18069-18837 + | 9 16
## [4] chr1 18069-18837 - | 7 4
## [5] chr1 18185-18837 - | 2 0
## ... ... ... ... . ... ...
## [42] chr1 14166-14362 + | 0 1
## [43] chr1 19308-23623 - | 0 2
## [44] chr1 29327-32271 + | 0 2
## [45] chr1 29327-32271 - | 0 1
## [46] chr3 2504-5589 - | 0 3
## -------
## seqinfo: 3 sequences from an unspecified genome; no seqlengths
About half of the exon-exon junctions detected in this sample dataset correspond to known introns; they tend to be the ones with higher coverage:
knownIntrons <- unlist(intronsByTranscript(txdb))
isKnown <- overlapsAny(exonJunctions, knownIntrons, type = "equal")
table(isKnown)## isKnown
## FALSE TRUE
## 25 21
## $`FALSE`
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 1 3 7 47 31 342
##
## $`TRUE`
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 1.0 2.0 16.0 50.7 91.0 210.0
When quantifying exon junctions, only spliced alignments will be
included in the quantification. It is also possible to only include
unspliced alignments in the quantification, for example when counting
exon body alignments that complement the exon junction alignments. This
can be done using the includeSpliced argument from
qCount:
## extracting exon regions from TxDb...done
## counting alignments...done
## width Sample1 Sample2
## Min. :0 Min. : 0.0 Min. : 0.0
## 1st Qu.:0 1st Qu.: 0.0 1st Qu.: 0.0
## Median :0 Median : 3.0 Median : 1.0
## Mean :0 Mean : 42.3 Mean : 34.6
## 3rd Qu.:0 3rd Qu.: 47.5 3rd Qu.: 50.5
## Max. :0 Max. :819.0 Max. :650.0
## collecting quality control data
## creating QC plots
Expression profiling of miRNAs differs only slightly from the profiling of mRNAs. There are a few details that need special care, which are outlined in this section.
Again, we start the example workflow by copying the example data
files into the current working directly, into a subfolder called
"extdata".
## [1] TRUE
As a next step, we need to remove library adapter sequences from short RNA reads. Most sequencing experiments generate reads that are longer than the average length of a miRNA (22nt). Therefore, the read sequence will run through the miRNA into the library adapter sequence and would not match when aligned in full to the reference genome.
We can remove those adapter sequences using
preprocessReads (see section @ref(preprocessReads) for more
details), which for each input sequence file will generate an output
sequence file containing appropriately truncated sequences. In the
example below, we get the input sequence filenames from
sampleFile, and also prepare an updated
sampleFile2 that refers to newly generated processed
sequence files:
# prepare sample file with processed reads filenames
sampleFile <- file.path("extdata", "samples_mirna.txt")
sampleFile## [1] "extdata/samples_mirna.txt"
## [1] "extdata/samples_mirna_processed.txt"
## FileName SampleName
## 1 mirna_1.fa miRNAs
tab2 <- tab
tab2$FileName <- sub(".fa", "_processed.fa", tab$FileName)
write.table(tab2, sampleFile2, sep = "\t", quote = FALSE, row.names = FALSE)
tab2## FileName SampleName
## 1 mirna_1_processed.fa miRNAs
# remove adapters
oldwd <- setwd(dirname(sampleFile))
res <- preprocessReads(tab$FileName,
tab2$FileName,
Rpattern = "TGGAATTCTCGGGTGCCAAGG")## filtering mirna_1.fa
## mirna_1.fa
## totalSequences 1000
## matchTo5pAdapter 0
## matchTo3pAdapter 1000
## tooShort 0
## tooManyN 0
## lowComplexity 0
## totalPassed 1000
The miRNA reads in mirna_1.fa are by the way synthetic
sequences and do not correspond to any existing miRNAs. As you can see
above from the return value of preprocessReads, all reads
matched to the 3’-adapter and were therefore truncated, reducing their
length to roughly the expected 22nt:
# get read lengths
library(Biostrings)
oldwd <- setwd(dirname(sampleFile))
lens <- fasta.seqlengths(tab$FileName, nrec = 1e5)
lens2 <- fasta.seqlengths(tab2$FileName, nrec = 1e5)
setwd(oldwd)
# plot length distribution
lensTab <- rbind(raw = tabulate(lens, 50),
processed = tabulate(lens2, 50))
colnames(lensTab) <- 1:50
barplot(lensTab/rowSums(lensTab)*100,
xlab = "Read length (nt)", ylab = "Percent of reads")
legend(x = "topleft", bty = "n", fill = gray.colors(2),
legend = rownames(lensTab))Next, we create alignments using qAlign. In contrast to
the general RNA-seq workflow (section @ref(RNAseq)), alignment time can
be reduced by using the default unspliced alignment
(splicedAlignment=FALSE). Importantly, we need to set
maxHits=50 or similar to also align reads that perfectly
match the genome multiple times. This is required because of the miRNAs
that are encoded by multiple genes. Reads from such miRNAs would not be
aligned and thus their expression would be underestimated if using the
default maxHits=1. An example of such a multiply-encoded
miRNA is mmu-miR-669a-5p, which has twelve exact copies in the mm10
genome assembly according to mirBase19.
## alignment files missing - need to:
## create 1 genomic alignment(s)
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## ddab87c07814: 1
## Performing genomic alignments for 1 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff565bb3fd2.txt
## Genomic alignments have been created successfully
## seqlength mapped unmapped
## miRNAs:genome 95000 1000 0
A more detailed picture of the experiments’ quality can be obtained
using qQCReport(proj3, "qcreport.pdf") or similar (see also
section @ref(qQCReport)).
As with other experiment types, miRNAs are quantified using
qCount. For this purpose, we first construct a query
GRanges object with the genomic locations of mature miRNAs.
The locations can be obtained from the mirbase.db
package, or directly from the species-specific gff files provided by the
mirBase database (e.g. (ftp://mirbase.org/pub/mirbase/19/genomes/mmu.gff3)). For
the purpose of this example, the QuasR
package provides a small gff file ("mirbaseXX_qsr.gff3")
that is formatted as the ones available from mirBase. The gff file
contains both the locations of pre-miRNAs (hairpin precursors), as well
as mature miRNAs. The two can be discriminated by their
"type":
mirs <- import("extdata/mirbaseXX_qsr.gff3")
names(mirs) <- mirs$Name
preMirs <- mirs[ mirs$type == "miRNA_primary_transcript" ]
matureMirs <- mirs[ mirs$type == "miRNA" ]Please note that the name attribute of the GRanges
object must be set appropriately, so that qCount can
identify a single mature miRNA sequence that is encoded by multiple loci
(see below) by their identical names. In this example, there are no
multiply-encoded mature miRNAs, but in a real sample, you can detect
them for example with table(names(mirs)).
The preMirs and matureMirs could now be
used as query in qCount. In practise however,
miRNA seem to not always be processed with high accuracy. Many miRNA
reads that start one or two bases earlier or later can be observed in
real data, and also their length may vary for a few bases. This is the
case for the synthetic miRNAs used in this example, whose lengthes and
start positions have been sampled from a read data set:
library(Rsamtools)
alns <- scanBam(alignments(proj3)$genome$FileName,
param = ScanBamParam(what = scanBamWhat(),
which = preMirs[1]))[[1]]
alnsIR <- IRanges(start = alns$pos - start(preMirs), width = alns$qwidth)
mp <- barplot(as.vector(coverage(alnsIR)), names.arg = seq_len(max(end(alnsIR))),
xlab = "Relative position in pre-miRNA",
ylab = "Alignment coverage")
rect(xleft = mp[start(matureMirs) - start(preMirs) + 1,1],
ybottom = -par('cxy')[2],
xright = mp[end(matureMirs) - start(preMirs) + 1,1],
ytop = 0, col = "#CCAA0088", border = NA, xpd = NA)By default, qCount will count alignments that have their
5’-end within the query region (see selectReadPosition
argument). The 5’-end correspond to the lower (left) coordinate for
alignments on the plus strand, and to the higher (right) coordinate for
alignments on the minus strand. In order not to miss miRNAs that have a
couple of extra or missing bases, we therefore construct a query window
around the 5’-end of each mature miRNA, by adding three bases up- and
downstream:
The resulting extended query is then used to quantify mature miRNAs.
Multiple-encoded miRNAs will be represented by multiple ranges in
matureMirs and matureMirsExtended, which have
identical names. qCount will automatically sum all
alignments from any of those regions and return a single number per
sample and unique miRNA name.
## counting alignments...done
## width miRNAs
## qsr-miR-9876-5p 7 13
## qsr-miR-9876-3p 7 984
## counting alignments...done
## width miRNAs
## qsr-mir-9876 75 1000
Sequencing of bisulfite-converted genomic DNA allows detection of
methylated cytosines, which in mammalian genomes typically occur in the
context of CpG dinucleotides. The treatment of DNA with bisulfite
induces deamination of non-methylated cytosines, converting them to
uracils. Sequencing and aligning of such bisulfite-converted DNA results
in C-to-T mismatches. Both alignment of converted reads, as well as the
interpretation of the alignments for calculation of methylation levels
require specific approaches and are supported in QuasR by
qAlign (bisulfite argument, section
@ref(qAlign)) and qMeth (section @ref(qMeth)),
respectively.
We start the analysis by copying the example data files into the
current working directly, into a subfolder called
"extdata". Then, bisulfite-specific alignment is selected
in qAlign by setting bisulfite to
"dir" for a directional experiment, or to
"undir" for an undirectional Bis-seq experiment:
## [1] TRUE
sampleFile <- "extdata/samples_bis_single.txt"
genomeFile <- "extdata/hg19sub.fa"
proj4 <- qAlign(sampleFile, genomeFile, bisulfite = "dir")## alignment files missing - need to:
## create alignment index for the genome
## create 1 genomic alignment(s)
## Creating an RbowtieCtoT index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub.fa
## Finished creating index
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## ddab87c07814: 1
## Performing genomic alignments for 1 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff518bc6a4.txt
## Genomic alignments have been created successfully
## Project: qProject
## Options : maxHits : 1
## paired : no
## splicedAlignment: FALSE
## bisulfite : dir
## snpFile : none
## geneAnnotation : none
## Aligner : Rbowtie v1.51.0 (parameters: -k 2 --best --strata -v 2)
## Genome : /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignet.../hg19sub.fa (file)
##
## Reads : 1 file, 1 sample (fasta format):
## 1. bis_1_1.fa.bz2 Sample1
##
## Genome alignments: directory: same as reads
## 1. bis_1_1_1ff5170b3083.bam
##
## Aux. alignments: none
The resulting alignments are not different from those of non-Bis-seq
experiments, apart from the fact that they may contain many C-to-T (or
A-to-G) mismatches that are not counted as mismatches when aligning the
reads. The number of alignments in specific genomic regions could be
quantified using qCount as with ChIP-seq or RNA-seq
experiments. For quantification of methylation the qMeth
function is used:
## GRanges object with 3110 ranges and 2 metadata columns:
## seqnames ranges strand | Sample1_T Sample1_M
## <Rle> <IRanges> <Rle> | <integer> <integer>
## [1] chr1 19-20 * | 1 1
## [2] chr1 21-22 * | 1 1
## [3] chr1 54-55 * | 3 1
## [4] chr1 57-58 * | 3 0
## [5] chr1 80-81 * | 6 5
## ... ... ... ... . ... ...
## [3106] chr3 44957-44958 * | 8 7
## [3107] chr3 44977-44978 * | 5 3
## [3108] chr3 44981-44982 * | 4 3
## [3109] chr3 44989-44990 * | 1 1
## [3110] chr3 44993-44994 * | 1 1
## -------
## seqinfo: 3 sequences from an unspecified genome
By default, qMeth quantifies methylation for all
cytosines in CpG contexts, combining the data from plus and minus
strands (mode="CpGcomb"). The results are returned as a
GRanges object with coordinates of each CpG, and two
metadata columns for each input sequence file in the
qProject object. These two columns contain the total number
of aligned reads that overlap a given CpG (C-to-C matches or C-to-T
mismatches, suffix _T in the column name), and the number
of read alignments that had a C-to-C match at that position (methylated
events, suffix _M).
Independent of the number of alignments, the returned object will
list all CpGs in the target genome including the ones that have zero
coverage, unless you set keepZero=FALSE:
## [1] 3110
## [1] 3110
## [1] 2929
The fraction methylation can easily be obtained as the ratio between
_M and _T columns:
## Min. 1st Qu. Median Mean 3rd Qu. Max. NA's
## 0.0 75.0 90.9 75.4 100.0 100.0 181
axisTrack <- GenomeAxisTrack()
dTrack1 <- DataTrack(range = gr1, name = "H3K4me3", type = "h")
dTrack2 <- DataTrack(range = meth, data = percMeth,
name = "Methylation", type = "p")
txTrack <- GeneRegionTrack(txdb, name = "Transcripts", showId = TRUE)
plotTracks(list(axisTrack, dTrack1, dTrack2, txTrack),
chromosome = "chr3", extend.left = 1000)If qMeth is called without a query
argument, it will by default return methylation states for each C or CpG
in the genome. Using a query argument it is possible to
restrict the analysis to specific genomic regions, and if using in
addition collapseByQueryRegion=TRUE, the single base
methylation states will further be combined for all C’s that are
contained in the same query region:
## GRanges object with 1 range and 2 metadata columns:
## seqnames ranges strand | Sample1_T Sample1_M
## <Rle> <IRanges> <Rle> | <integer> <integer>
## [1] chr1 31633-31634 * | 10 2
## -------
## seqinfo: 3 sequences from an unspecified genome
## GRanges object with 12 ranges and 2 metadata columns:
## seqnames ranges strand | Sample1_T Sample1_M
## <Rle> <IRanges> <Rle> | <numeric> <numeric>
## [1] chr1 31629-33128 + | 426 74
## [2] chr1 6452-7951 - | 388 244
## [3] chr1 14013-15512 - | 627 560
## [4] chr1 31882-33381 - | 522 232
## [5] chr2 1795-3294 + | 997 539
## ... ... ... ... . ... ...
## [8] chr3 1276-2775 + | 715 253
## [9] chr3 19069-20568 + | 253 204
## [10] chr3 26692-28191 + | 934 818
## [11] chr3 26834-28333 + | 934 777
## [12] chr3 13102-14601 - | 307 287
## -------
## seqinfo: 3 sequences from an unspecified genome
Finally, qMeth allows the retrieval of methylation
states for individual molecules (per alignment). This is done by using a
query containing a single genomic region (typically small,
such as a PCR amplicon) and setting
reportLevel="alignment". In that case, the return value of
qMeth will be a list (over samples) of lists (with four
elements giving the identities of alignment, C nucleotide, strand and
the methylation state). See the documentation of qMeth for
more details.
All experiment types supported by QuasR
(ChIP-seq, RNA-seq and Bis-seq; only alignments to the genome, but not
to auxiliaries) can also be analyzed in an allele-specific manner. For
this, a file containing genomic location and the two alleles of known
sequence polymorphisms has to be provided to the snpFile
argument of qAlign. The file is in tab-delimited text
format without a header and contains four columns with chromosome name,
position, reference allele and alternative allele.
Below is an example of a SNP file, also available from
system.file(package="QuasR", "extdata", "hg19sub_snp.txt"):
chr1 3199 C T chr1 3277 C T chr1 4162 C T chr1 4195 C T ...
For a given locus, either reference or alternative allele may but
does not have to be identical to the sequence of the reference genome
(genomeFile in this case). To avoid an alignment bias, all
reads are aligned separately to each of the two new genomes, which
QuasR
generates by injecting the SNPs listed in snpFile
into the reference genome. Finally, the two alignment files are
combined, only retaining the best alignment for each read. While this
procedure takes more than twice as long as aligning against a single
genome, it has the advantage to correctly align reads even in regions of
high SNP density and has been shown to produce more accurate
results.
While combining alignments, each read is classified into one of three
groups (stored in the bam files under the XV
tag):
Using these alignment classifications, the qCount and
qMeth functions will produce three counts instead of a
single count; one for each class. The column names will be suffixed by
_R, _U and _A.
The examples below use data provided with the QuasR
package, which is first copied to the current working directory, into a
subfolder called "extdata":
## [1] TRUE
The example below aligns the same reads that were also used in the
ChIP-seq workflow (section @ref(ChIPseq)), but this time using a
snpFile:
sampleFile <- "extdata/samples_chip_single.txt"
genomeFile <- "extdata/hg19sub.fa"
snpFile <- "extdata/hg19sub_snp.txt"
proj1SNP <- qAlign(sampleFile, genome = genomeFile, snpFile = snpFile)## alignment files missing - need to:
## create alignment index for the genome
## create 2 genomic alignment(s)
## Reading and processing the SNP file: /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt
## Creating the genome fasta file containing the SNPs: /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.R.fa
## Creating the genome fasta file containing the SNPs: /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.A.fa
## Creating a .fai file for the snp genome: /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.R.fa
## Creating a .fai file for the snp genome: /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.A.fa
## Creating an Rbowtie index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.R.fa
## Finished creating index
## Creating an Rbowtie index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.A.fa
## Finished creating index
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## ddab87c07814: 1
## Performing genomic alignments for 2 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff52b73b562.txt
## Genomic alignments have been created successfully
## Project: qProject
## Options : maxHits : 1
## paired : no
## splicedAlignment: FALSE
## bisulfite : no
## snpFile : /tmp/RtmpjnpgPc/Rbuild1ba3f8f.../hg19sub_snp.txt
## geneAnnotation : none
## Aligner : Rbowtie v1.51.0 (parameters: -k 2 --best --strata -v 2)
## Genome : /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignet.../hg19sub.fa (file)
##
## Reads : 2 files, 2 samples (fastq format):
## 1. chip_1_1.fq.bz2 Sample1 (phred33)
## 2. chip_2_1.fq.bz2 Sample2 (phred33)
##
## Genome alignments: directory: same as reads
## 1. chip_1_1_1ff5166dfe02.bam
## 2. chip_2_1_1ff57ea14127.bam
##
## Aux. alignments: none
Instead of one count per promoter region and sample,
qCount now returns three (promRegSel was
generated in the ChIP-seq example workflow):
## counting alignments...done
## width Sample1 Sample2
## ENSG00000176022 1500 157 701
## ENSG00000186891 1500 22 5
## ENSG00000186827 1500 10 3
## ENSG00000078808 1500 73 558
## ENSG00000171863 1500 94 339
## ENSG00000252531 1500 59 9
## counting alignments...done
## width Sample1_R Sample1_U Sample1_A Sample2_R Sample2_U
## ENSG00000176022 1500 0 133 0 0 559
## ENSG00000186891 1500 4 16 0 0 5
## ENSG00000186827 1500 2 8 0 0 2
## ENSG00000078808 1500 0 59 0 0 432
## ENSG00000171863 1500 4 78 0 8 263
## ENSG00000252531 1500 3 50 2 0 6
## Sample2_A
## ENSG00000176022 0
## ENSG00000186891 0
## ENSG00000186827 0
## ENSG00000078808 0
## ENSG00000171863 0
## ENSG00000252531 0
The example below illustrates use of a snpFile for
Bis-seq experiments. Similarly as for qCount, the count
types are labeled by R, U and A.
These labels are added to the total and methylated column suffixes
_T and _M, resulting in a total of six instead
of two counts per feature and sample:
sampleFile <- "extdata/samples_bis_single.txt"
genomeFile <- "extdata/hg19sub.fa"
proj4SNP <- qAlign(sampleFile, genomeFile,
snpFile = snpFile, bisulfite = "dir")## alignment files missing - need to:
## create alignment index for the genome
## create 1 genomic alignment(s)
## Creating an RbowtieCtoT index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.R.fa
## Finished creating index
## Creating an RbowtieCtoT index for /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/extdata/hg19sub_snp.txt.hg19sub.fa.A.fa
## Finished creating index
## Testing the compute nodes...OK
## Loading QuasR on the compute nodes...preparing to run on 1 nodes...done
## Available cores:
## ddab87c07814: 1
## Performing genomic alignments for 1 samples. See progress in the log file:
## /tmp/RtmpjnpgPc/Rbuild1ba3f8f740c/QuasR/vignettes/QuasR_log_1ff579c52a7e.txt
## Genomic alignments have been created successfully
## GRanges object with 6 ranges and 6 metadata columns:
## seqnames ranges strand | Sample1_TR Sample1_MR Sample1_TU Sample1_MU
## <Rle> <IRanges> <Rle> | <integer> <integer> <integer> <integer>
## [1] chr1 19-20 * | 0 0 1 1
## [2] chr1 21-22 * | 0 0 1 1
## [3] chr1 54-55 * | 0 0 3 1
## [4] chr1 57-58 * | 0 0 3 0
## [5] chr1 80-81 * | 0 0 6 5
## [6] chr1 103-104 * | 0 0 6 5
## Sample1_TA Sample1_MA
## <integer> <integer>
## [1] 0 0
## [2] 0 0
## [3] 0 0
## [4] 0 0
## [5] 0 0
## [6] 0 0
## -------
## seqinfo: 3 sequences from an unspecified genome
Please refer to the QuasR
reference manual or the function documentation (e.g. using
?qAlign) for a complete description of QuasR
functions. The descriptions provided below are meant to give an overview
over all functions and summarize the purpose of each one.
preprocessReadsThe preprocessReads function can be used to prepare the
input sequences before alignment to the reference genome, for example to
filter out low quality reads unlikely to produce informative alignments.
When working with paired-end experiments, the paired reads are expected
to be contained in identical order in two separate files. For this
reason, both reads of a pair are filtered out if any of the two reads
fulfills the filtering criteria. The following types of filtering tasks
can be performed (in the order as listed):
trimLRPatterns from the
Biostrings
package (Pages et al., n.d.).nBases N bases, are shorter than
minLength or have a dinucleotide complexity of less than
complexity-times the average complexity of the human genome
sequence).The dinucleotide complexity is calculated in bits as Shannon entropy using the following formula \(-\sum_i f_i \cdot \log_2 f_i\), where \(f_i\) is the frequency of dinucleotide \(i\) (\(i=1, 2, ..., 16\)).
qAlignqAlign is the function that generates alignment files in
bam format, for all input sequence files listed in
sampleFile (see section @ref(sampleFile)), against the
reference genome (genome argument), and for reads that do
not match to the reference genome, against one or several auxiliary
target sequences (auxiliaryFile, see section
@ref(auxiliaryFile)).
The reference genome can be provided either as a fasta
sequence file or as a BSgenome package name (see section
@ref(genome)). If a BSgenome package is not found in the
installed packages, qAlign will abort with a description
how the missing package can be installed from Bioconductor.
The alignment program is set by aligner, and parameters
by maxHits, paired,
splicedAlignment and alignmentParameter.
Currently, aligner can only be set to
"Rbowtie", which is a wrapper for bowtie (Langmead et al. 2009) and SpliceMap
(Au et al. 2010), or
"Rhisat2", which is a wrapper for HISAT2 (Kim, Langmead, and Salzberg 2015). When
aligner="Rbowtie", SpliceMap will be used if
splicedAlignment=TRUE (not recommended anymore except for
reproducing older analyses). However, it is recommended to create
spliced alignment using
splicedAlignment=TRUE, aligner="Rhisat2", which will use
the HISAT2 aligner and typically leads to more sensistive
alignments and shorter alignment times compared to SpliceMap.
The alignment strategy is furthermore affected by the parameters
snpFile (alignments to variant genomes containing sequence
polymorphisms) and bisulfite (alignment of
bisulfite-converted reads). Finally, clObj can be used to
enable parallelized alignment, sorting and conversion to
bam format.
For each input sequence file listed in sampleFile, one
bam file with alignments to the reference genome will be
generated, and an additional one for each auxiliary sequence file listed
in auxiliaryFile. By default, these bam files
are stored at the same location as the sequence files, unless a
different location is specified under alignmentsDir. If
compatible alignment files are found at this location, they will not be
regenerated, which allows re-use of the same sequencing samples in
multiple analysis projects by listing them in several project-specific
sampleFiles.
The alignment process produces temporary files, such as decompressed
input sequence files or raw alignment files before conversion to
bam format, which can be several times the size of the
input sequence files. These temporary files are stored in the directory
specified by cacheDir, which defaults to the
R process temporary directory returned by
tempdir(). The location of tempdir() can be
set using environment variables (see ?tempdir).
qAlign returns a qProject object that
contains all file names and paths, as well as all alignment parameters
necessary for further analysis (see section @ref(qProject) for methods
to access the information contained in a qProject
object).
qProject classThe qProject objects are returned by qAlign
and contain all information about a sequencing experiment needed for
further analysis. It is the main argument passed to the functions that
start with a q letter, such as qCount,
qQCReport and qExportWig. Some information
inside of a qProject object can be accessed by specific
methods (in the examples below, x is a
qProject object):
length(x) gets the number of input files.genome(x) gets the reference genome as a
character(1). The type of genome is stored as an attribute
in attr(genome(x),"genomeFormat"): "BSgenome"
indicates that genome(x) refers to the name of a
BSgenome package, "file" indicates that it
contains the path and file name of a genome in fasta
format.auxiliaries(x) gets a data.frame with
auxiliary target sequences. The data.frame has one row per
auxiliary target file, and two columns “FileName” and “AuxName”.alignments(x) gets a list with two elements
"genome" and "aux". "genome"
contains a data.frame with length(x) rows and
two columns "FileName" (containing the path to bam files
with genomic alignments) and "SampleName".
"aux" contains a data.frame with one row per
auxiliary target file (with auxiliary names as row names), and
length(x) columns (one per input sequence file).x[i] returns a qProject object instance
with i input files, where i can be an
NA-free logical, numeric, or character vector.qQCReportThe qQCReport function samples a random subset of
sequences and alignments from each sample or input file and generates a
series of diagnostic plots for estimating data quality. The available
plots vary depending on the types of available input (fasta, fastq, bam
files or qProject object; paired-end or single-end). The
plots below show the currently available plots as produced by the
ChIP-seq example in section @ref(ChIPseq) (except for the fragment size
distributions which are based on an unspliced alignment of paired-end
RNA seq reads):
Quality score boxplot shows the distribution of
base quality values as a box plot for each position in the input
sequence. The background color (green, orange or red) indicates ranges
of high, intermediate and low qualities.
Nucleotide frequency plot shows the frequency of
A, C, G, T and N bases by position in the read.
Duplication level plot shows for each sample the
fraction of reads observed at different duplication levels (e.g. once,
two-times, three-times, etc.). In addition, the most frequent sequences
are listed.
Mapping statistics shows fractions of reads that
were (un)mappable to the reference genome.
Library complexity shows fractions of unique
read(-pair) alignment positions. Please note that this measure is not
independent from the total number of reads in a library, and is best
compared between libraries of similar sizes.
Mismatch frequency shows the frequency and
position (relative to the read sequence) of mismatches in the alignments
against the reference genome.
Mismatch types shows the frequency of read bases
that caused mismatches in the alignments to the reference genome,
separately for each genome base.
Fragment size shows the distribution of fragment
sizes inferred from aligned read pairs.
alignmentStatsalignmentStats is comparable to the
idxstats function from Samtools; it returns the size of the
target sequence, as well as the number of mapped and unmapped reads that
are contained in an indexed bam file. The function works
for arguments of type qProject, as well as on a string with
one or several bam file names. There is however a small
difference in the two that is illustrated in the following example,
which uses the qProject object from the ChIP-seq
workflow:
## seqlength mapped unmapped
## chip_1_1_1ff570ec201.bam 95000 2339 258
## chip_2_1_1ff5b126fd3.bam 95000 3609 505
## seqlength mapped unmapped
## chip_1_1_1ff54dd3613d.bam 5386 251 0
## chip_2_1_1ff528cfefc4.bam 5386 493 0
## seqlength mapped unmapped
## Sample1:genome 95000 2339 258
## Sample2:genome 95000 3609 505
## Sample1:phiX174 5386 251 7
## Sample2:phiX174 5386 493 12
If calling alignmentStats on the bam files directly as
in the first two expressions of the above example, the returned numbers
correspond exactly to what you would obtain by the idxstats
function from Samtools, only that the latter would report them
separately for each target sequence, while alignmentStats
sums them for each bam file. These numbers correctly state
that there are zero unmapped reads in the auxiliary bam
files. However, if calling alignmentStats on a
qProject object, it will report 7 and 12 unmapped reads in
the auxiliary bam files. This is because
alignmentStats is aware that unmapped reads are removed
from auxiliary bam files by QuasR, but
can be calculated from the total number of reads to be aligned to the
auxiliary target, which equals the number of unmapped reads in the
corresponding genomic bam file.
qExportWigqExportWig creates fixed-step wig files (see (http://genome.ucsc.edu/goldenPath/help/wiggle.html) for
format definition) from the genomic alignments contained in a
qProject object. The combine argument controls
if several input files are combined into a single multi-track wig file,
or if they are exported as individual wig files. Alignments of single
read experiments can be shifted towards there 3’-end using
shift; paired-end alignments are automatically shifted by
half the insert size. The resolution of the created wig file is defines
by the binsize argument, and if scaling=TRUE,
multiple alignment files in the qProject object are scaled
by their total number of aligned reads per sample.
qCountqCount is the workhorse for counting alignments that
overlap query regions. Usage and details on parameters can be obtained
from the qCount function documentation. Two aspects that
are of special importance are also discussed here:
How an alignment overlap with a query region is defined can be
controlled by the following arguments of qCount:
selectReadPosition specifies the read base that serves
as a reference for overlaps with query regions. The alignment position
of that base, eventually after shifting (see below), needs to be
contained in the query region for an overlap.
selectReadPosition can be set to "start" (the
default) or "end" , which refer to the biological start
(5’-end) and end (3’-end) of the read. For example, the
"start" of a read aligned to the plus strand is the
leftmost base in the alignment (the one with the lowest coordinate), and
the "end" of a read aligned to the minus strand is also its
leftmost base in the alignment.shift allows shifting of alignments towards their
3’-end prior to overlap determination and counting. This can be helpful
to increase resolution of ChIP-seq experiments by moving alignments by
half the immuno-precipitated fragment size towards the middle of
fragments. shift can either contain "integer"
values that specify the shift size, or for paired-end experiments, it
can be set to the keyword "halfInsert", which will estimate
the true fragment size from the distance between aligned read pairs and
shift the alignments accordingly.orientation controls the interpretation of alignment
strand relative to the strand of the query region. The default value
"any" will count all overlapping alignments, irrespective
of the strand. This setting is for example used in an unstranded RNA-seq
experiment where both sense and antisense reads are generated from an
mRNA. A value of "same" will only count the alignments on
the same strand as the query region (e.g. in a stranded RNA-seq
experiment), and "opposite" will only count the alignments
on the opposite strand from the query region (e.g. to quantify
anti-sense transcription in a stranded RNA-seq experiment).useRead only applies to paired-end experiments and
allows to quantify either all alignments (useRead="any"),
or only the first (useRead="first") or last
(useRead="last") read from each read pair or read group.
Note that for useRead="any" (the default), an alignment
pair that is fully contained within a query region will contribute two
counts to the value of that region.includeSpliced: When set to FALSE, spliced
alignments will be excluded from the quantification. This could be
useful for example to avoid redundant counting of reads when the spliced
alignments are quantified separately using
reportLevel="junction".qCountThe features to be quantified are specified by the query
argument. At the same time, the type of query selects the
mode of quantification. qCount supports three different
types of query arguments and implements three corresponding
quantification types, which primarily differ in the way they deal with
redundancy, such as query bases that are contained in more than one
query region. A fourth quantification mode allows counting of alignments
supporting exon-exon juctions:
GRanges query: Overlapping alignments are counted
separately for each coordinate region in the query object. If multiple
regions have identical names, their counts will be summed, counting each
alignment only once even if it overlaps more than one of these regions.
Alignments may however be counted more than once if they overlap
multiple regions with different names. This mode is for example used to
quantify ChIP-seq alignments in promoter regions (see section
@ref(ChIPseq)), or gene expression levels in an RNA-seq experiment
(using a ‘query’ with exon regions named by gene).GRangesList query: Alignments are counted and summed
for each list element in the query object if they overlap with any of
the regions contained in the list element. The order of the list
elements defines a hierarchy for quantification: Alignment will only be
counted for the first element (the one with the lowest index in the
query) that they overlap, but not for any potential further list
elements containing overlapping regions. This mode can be used to
hierarchically and uniquely count (assign) each alignment to a one of
several groups of regions (the elements in the query), for example to
estimate the fractions of different classes of RNA in an RNA-seq
experiment (rRNA, tRNA, snRNA, snoRNA, mRNA, etc.)TxDb query: Used to extract regions from annotation and
report alignment counts depending on the value of the
reportLevel argument. If reportLevel="exon",
alignments overlapping each exon in the query are counted. If
reportLevel="gene", alignment counts for all exons of a
gene will be summed, counting each alignment only once even if it
overlaps multiple annotated exons of a gene. These are useful to
calculate exon or gene expression levels in RNA-seq experiments based on
the annotation in a TxDb object. If
reportLevel="promoter", the promoters function
from package GenomicFeatures
is used with default arguments to extract promoter regions around
transcript start sites, e.g. to quantify alignments inf a ChIP-seq
experiment.NULL for
reportLevel="junction": The query argument is
ignored if reportLevel is set to "junction",
and qCount will count the number of alignments supporting
each exon-exon junction detected in any of the samples in
proj. The arguments selectReadPosition,
shift, orientation, useRead and
mask will have no effect in this quantification mode.qProfileThe qProfile function differs from qCount
in that it returns alignments counts relative to their position in the
query region. Except for upstream and
downstream, the arguments of qProfile and
qCount are the same. This section will describe these two
additional arguments; more details on the other arguments are available
in section @ref(qCount) and from the qProfile function
documentation.
The regions to be profiled are anchored by the biological start
position, which are aligned at position zero in the return value. The
biological start position is defined as start(query) for
regions on the plus strand and end(query) for regions on
the minus strand. The anchor positions are extended to the left and
right sides by the number of bases indicated in the
upstream and downstream arguments.
upstream indicates the number of bases upstream of the
anchor position, which is on the left side of the anchor point for
regions on the plus strand and on the right side for regions on the
minus strand.downstream indicates the number of bases downstream of
the anchor position, which is on the left side of the anchor point for
regions on the plus strand and on the left side for regions on the minus
strand.Be aware that query regions with a * strand are handled
the same way as regions on the plus strand.
qMethqMeth is used exclusively for Bis-seq experiments. In
contrast to qCount, which counts the number of read
alignments per query region, qMeth quantifies the number of
C and T bases per cytosine in query regions, in order to determine
methylation status.
qMeth can be run in one of four modes, controlled by the
mode argument:
CpGcomb: Only C’s in CpG context are considered. It is
assumed that methylation status of the CpG base-pair on both strands is
identical. Therefore, the total and methylated counts obtained for the C
at position \(i\) and the C on the
opposite strand at position \(i+1\) are
summed.CpG: As with CpGcomb, only C’s in CpG
context are quantified. However, counts from opposite strand are not
summed, resulting in separate output values for C’s on both
strands.allC: All C’s contained in query regions are
quantified, keeping C’s from either strand separate. While this mode
allows quantification of non-CpG methylation, it should be used with
care, as the large result could use up available memory. In that case, a
possible work-around is to divide the region of interest (e.g. the
genome) into several regions (e.g. chromosomes) and call
qMeth separately for each region.var: In this mode, only alignments on the opposite
strand from C’s are analysed in order to collect evidence for sequence
polymorphisms. Methylated C’s are hot-spots for C-to-T transitions,
which in a Bis-seq experiment cannot be discriminated from completely
unmethylated C’s. The information is however contained in alignments to
the G from the opposite strand: Reads containing a G are consistent with
a non-mutated C, and reads with an A support the presence of a sequence
polymorphism. qMeth(..., mode="var") returns counts for
total and matching bases for all C’s on both strands. A low fraction of
matching bases is an indication of a mutation and can be used as a basis
to identify mutated positions in the studied genome relative to the
reference genome. Such positions should not be included in the
quantification of methylation.When using qMeth in a allele-specific quantification
(see also section @ref(alleleSpecificAnalysis), cytosines (or CpGs) that
overlap a sequence polymorphism will not be quantified.
The output in this vignette was produced under:
## R version 4.5.2 (2025-10-31)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.3 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=C
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] grid stats4 parallel stats graphics grDevices utils
## [8] datasets methods base
##
## other attached packages:
## [1] Gviz_1.53.1 txdbmaker_1.7.3 GenomicFeatures_1.63.1
## [4] AnnotationDbi_1.73.0 Biobase_2.71.0 Rsamtools_2.27.0
## [7] BSgenome_1.79.1 rtracklayer_1.71.3 BiocIO_1.21.0
## [10] Biostrings_2.79.3 XVector_0.51.0 QuasR_1.49.3
## [13] Rbowtie_1.51.0 GenomicRanges_1.63.1 Seqinfo_1.1.0
## [16] IRanges_2.45.0 S4Vectors_0.49.0 BiocGenerics_0.57.0
## [19] generics_0.1.4 BiocStyle_2.39.0
##
## loaded via a namespace (and not attached):
## [1] RColorBrewer_1.1-3 sys_3.4.3
## [3] rstudioapi_0.17.1 jsonlite_2.0.0
## [5] magrittr_2.0.4 farver_2.1.2
## [7] rmarkdown_2.30 vctrs_0.6.5
## [9] memoise_2.0.1 RCurl_1.98-1.17
## [11] base64enc_0.1-3 htmltools_0.5.9
## [13] S4Arrays_1.11.1 progress_1.2.3
## [15] curl_7.0.0 SparseArray_1.11.10
## [17] Formula_1.2-5 sass_0.4.10
## [19] bslib_0.9.0 htmlwidgets_1.6.4
## [21] httr2_1.2.2 cachem_1.1.0
## [23] buildtools_1.0.0 GenomicAlignments_1.47.0
## [25] igraph_2.2.1 lifecycle_1.0.4
## [27] pkgconfig_2.0.3 Matrix_1.7-4
## [29] R6_2.6.1 fastmap_1.2.0
## [31] GenomeInfoDbData_1.2.15 MatrixGenerics_1.23.0
## [33] digest_0.6.39 colorspace_2.1-2
## [35] ShortRead_1.69.2 Hmisc_5.2-4
## [37] RSQLite_2.4.5 hwriter_1.3.2.1
## [39] filelock_1.0.3 httr_1.4.7
## [41] abind_1.4-8 compiler_4.5.2
## [43] bit64_4.6.0-1 htmlTable_2.4.3
## [45] S7_0.2.1 backports_1.5.0
## [47] BiocParallel_1.45.0 DBI_1.2.3
## [49] biomaRt_2.67.0 Rhisat2_1.27.0
## [51] rappdirs_0.3.3 DelayedArray_0.37.0
## [53] rjson_0.2.23 tools_4.5.2
## [55] foreign_0.8-90 nnet_7.3-20
## [57] glue_1.8.0 restfulr_0.0.16
## [59] checkmate_2.3.3 cluster_2.1.8.1
## [61] gtable_0.3.6 ensembldb_2.35.0
## [63] data.table_1.17.8 hms_1.1.4
## [65] pillar_1.11.1 stringr_1.6.0
## [67] dplyr_1.1.4 BiocFileCache_3.1.0
## [69] lattice_0.22-7 bit_4.6.0
## [71] deldir_2.0-4 biovizBase_1.57.1
## [73] tidyselect_1.2.1 maketools_1.3.2
## [75] knitr_1.51 gridExtra_2.3
## [77] ProtGenerics_1.43.0 SummarizedExperiment_1.41.0
## [79] xfun_0.55 matrixStats_1.5.0
## [81] stringi_1.8.7 UCSC.utils_1.7.1
## [83] lazyeval_0.2.2 yaml_2.3.12
## [85] evaluate_1.0.5 codetools_0.2-20
## [87] cigarillo_1.1.0 interp_1.1-6
## [89] GenomicFiles_1.45.2 tibble_3.3.0
## [91] BiocManager_1.30.27 cli_3.6.5
## [93] rpart_4.1.24 jquerylib_0.1.4
## [95] dichromat_2.0-0.1 Rcpp_1.1.0.8.1
## [97] GenomeInfoDb_1.47.2 dbplyr_2.5.1
## [99] png_0.1-8 RUnit_0.4.33.1
## [101] XML_3.99-0.20 ggplot2_4.0.1
## [103] blob_1.2.4 prettyunits_1.2.0
## [105] latticeExtra_0.6-31 jpeg_0.1-11
## [107] AnnotationFilter_1.35.0 SGSeq_1.43.1
## [109] bitops_1.0-9 pwalign_1.7.0
## [111] VariantAnnotation_1.57.1 scales_1.4.0
## [113] crayon_1.5.3 rlang_1.1.6
## [115] KEGGREST_1.51.1