The ShortRead package provides functionality for working with FASTQ files from high throughput sequence analysis. The package also contains functions for legacy (single-end, ungapped) aligned reads; for working with BAM files, please see the Rsamtools, GenomicRanges, GenomicAlignments and related packages.

1 Sample data

Sample FASTQ data are derived from ArrayExpress record E-MTAB-1147. Paired-end FASTQ files were retrieved and then sampled to 20,000 records with

sampler <- FastqSampler('E-MTAB-1147/fastq/ERR127302_1.fastq.gz', 20000)
set.seed(123); ERR127302_1 <- yield(sampler)
sampler <- FastqSampler('E-MTAB-1147/fastq/ERR127302_2.fastq.gz', 20000)
set.seed(123); ERR127302_2 <- yield(sampler)

2 Functionality

Functionality is summarized in Table 1.

Input FASTQ files are large so processing involves iteration in ‘chunks’ using FastqStreamer

strm <- FastqStreamer("a.fastq.gz")
repeat {
    fq <- yield(strm)
    if (length(fq) == 0)
        break
    ## process chunk
}

or drawing a random sample from the file

sampler <- FastqSampler("a.fastq.gz")
fq <- yield(sampler)

The default size for both streams and samples is 1M records; this volume of data fits easily into memory. Use countFastq to get a quick and memory-efficient count of the number of records and nucleotides in a file


Table 1: Key functions for working with FASTQ files
Input
FastqStreamer Iterate through FASTQ files in chunks
FastqSampler Draw random samples from FASTQ files
readFastq Read an entire FASTQ file into memory
writeFastq Write FASTQ objects to a connection (file)
countFastq Quickly count FASTQ records in files
Sequence and quality summary
alphabetFrequency Nucleotide or quality score use per read
alphabetByCycle Nucleotide or quality score use by cycle
alphabetScore Whole-read quality summary
encoding Character / ‘phred’ score mapping
Quality assessment
qa Visit FASTQ files to collect QA statistics
report Generate a quality assessment report
Filtering and trimming
srFilter Pre-defined and bespoke filters
trimTails, etc. Trim low-quality nucleotides
narrow Remove leading / trailing nucleotides
tables Summarize read occurrence
srduplicated, etc. Identify duplicate reads
filterFastq Filter reads from one file to another
fl <- system.file(package="ShortRead", "extdata", "E-MTAB-1147",
                  "ERR127302_1_subset.fastq.gz")
countFastq(fl)
##                             records nucleotides  scores
## ERR127302_1_subset.fastq.gz   20000     1440000 1440000

Small FASTQ files can be read into memory in their entirety using readFastq; we do this for our sample data

fq <- readFastq(fl)

The result of data input is an instance of class ShortReadQ (Table 2). This class contains reads, their quality scores, and optionally the id of the read.


Table 2: Primary data types in the ShortRead package.
DNAStringSet (Biostrings) Short read sequences
FastqQuality, etc. Quality encodings
ShortReadQ Reads, quality scores, and ids
fq
## class: ShortReadQ
## length: 20000 reads; width: 72 cycles
fq[1:5]
## class: ShortReadQ
## length: 5 reads; width: 72 cycles
head(sread(fq), 3)
## DNAStringSet object of length 3:
##     width seq
## [1]    72 GTCTGCTGTATCTGTGTCGGCTGTCTCGCGGGAC...GTCAATGAAGGCCTGGAATGTCACTACCCCCAG
## [2]    72 CTAGGGCAATCTTTGCAGCAATGAATGCCAATGG...CAGTGGCTTTTGAGGCCAGAGCAGACCTTCGGG
## [3]    72 TGGGCTGTTCCTTCTCACTGTGGCCTGACTAAAA...TGGCATTAAGAAAGAGTCACGTTTCCCAAGTCT
head(quality(fq), 3)
## class: FastqQuality
## quality:
## BStringSet object of length 3:
##     width seq
## [1]    72 HHHHHHHHHHHHHHHHHHHHEBDBB?B:BBGG<D...ABFEFBDBD@DDECEE3>:?;@@@>?=BAB?##
## [2]    72 IIIIHIIIGIIIIIIIHIIIIEGBGHIIIIHGII...IIIHIIIHIIIIIGIIIEGIIGBGE@DDGGGIG
## [3]    72 GGHBHGBGGGHHHHDHHHHHHHHHFGHHHHHHHH...HHHHHHHHGHFHHHHHHHHHHHHHH8AGDGGG>

The reads are represented as DNAStringSet instances, and can be manipulated with the rich tools defined in the Biostrings package. The quality scores are represented by a class that represents the quality encoding inferred from the file; the encoding in use can be discovered with

encoding(quality(fq))
##  !  "  #  $  %  &  '  (  )  *  +  ,  -  .  /  0  1  2  3  4  5  6  7  8  9  : 
##  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 
##  ;  <  =  >  ?  @  A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T 
## 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 
##  U  V  W  X  Y  Z  [ \\  ]  ^  _  `  a  b  c  d  e  f  g  h  i  j  k  l  m  n 
## 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 
##  o  p  q  r  s  t  u  v  w  x  y  z  {  |  }  ~ 
## 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93

The primary source of documentation for these classes is ?ShortReadQ and ?QualityScore.

3 Common workflows

3.1 Quality assessment

FASTQ files are often used for basic quality assessment, often to augment the purely technical QA that might be provided by the sequencing center with QA relevant to overall experimental design. A QA report is generated by creating a vector of paths to FASTQ files

fls <- dir("/path/to", "*fastq$", full=TRUE)

collecting statistics over the files

qaSummary <- qa(fls, type="fastq")

and creating and viewing a report

browseURL(report(qaSummary))

By default, the report is based on a sample of 1M reads.

These QA facilities are easily augmented by writing custom functions for reads sampled from files, or by exploiting the elements of the object returned from qa(), e.g., for an analysis of ArrayExpress experiment E-MTAB-1147:

qaSummary
## class: FastqQA(10)
## QA elements (access with qa[["elt"]]):
##   readCounts: data.frame(16 3)
##   baseCalls: data.frame(16 5)
##   readQualityScore: data.frame(8192 4)
##   baseQuality: data.frame(1504 3)
##   alignQuality: data.frame(16 3)
##   frequentSequences: data.frame(800 4)
##   sequenceDistribution: data.frame(1953 4)
##   perCycle: list(2)
##     baseCall: data.frame(5681 4)
##     quality: data.frame(44246 5)
##   perTile: list(2)
##     readCounts: data.frame(0 4)
##     medianReadQualityScore: data.frame(0 4)
##   adapterContamination: data.frame(16 1)

For instance, the count of reads in each lane is summarized in the readCounts element, and can be displayed as

head(qaSummary[["readCounts"]])
##                          read filter aligned
## ERR127302_1.fastq.gz 29741852     NA      NA
## ERR127302_2.fastq.gz 29741852     NA      NA
## ERR127303_1.fastq.gz 32665567     NA      NA
## ERR127303_2.fastq.gz 32665567     NA      NA
## ERR127304_1.fastq.gz 31876181     NA      NA
## ERR127304_2.fastq.gz 31876181     NA      NA
head(qaSummary[["baseCalls"]])
##                             A        C        G        T     N
## ERR127302_1.fastq.gz 16439860 19641395 19547421 16335620 35704
## ERR127302_2.fastq.gz 16238041 20020655 19608896 16060661 71747
## ERR127303_1.fastq.gz 16826258 19204659 19448727 16507994 12362
## ERR127303_2.fastq.gz 16426991 19822132 19374419 16324978 51480
## ERR127304_1.fastq.gz 16279217 19740457 19879137 16089405 11784
## ERR127304_2.fastq.gz 15984998 20297064 19812474 15853510 51954

The readCounts element contains a data frame with 1 row and 3 columns (these dimensions are indicated in the parenthetical annotation of readCounts in the output of qaSummary). The rows represent different lanes. The columns indicated the number of reads, the number of reads surviving the Solexa filtering criteria, and the number of reads aligned to the reference genome for the lane. The baseCalls element summarizes the base calls in the unfiltered reads.

The functions that produce the report tables and graphics are internal to the package. They can be accessed by calling ShortRead:::functionName where functionName is one of the functions listed below, organized by report section.

  • Run Summary: .ppnCount, .df2a, .laneLbl, .plotReadQuality
  • Read Distribution: .plotReadOccurrences, .freqSequences
  • Cycle Specific: .plotCycleBaseCall, .plotCycleQuality
  • Tile Performance: .atQuantile, .colorkeyNames, .plotTileLocalCoords, .tileGeometry, .plotTileCounts, .plotTileQualityScore
  • Alignment: .plotAlignQuality
  • Multiple Alignment: .plotMultipleAlignmentCount
  • Depth of Coverage: .plotDepthOfCoverage
  • Adapter Contamination: .ppnCount

3.2 Filtering and trimming

It is straightforward to create filters to eliminate reads or to trim reads based on diverse characteristics. The basic structure is to open a FASTQ file, iterate through chunks of the file, performing filtering or trimming steps, and appending the filtered data to a new file.

myFilterAndTrim <-
    function(fl, destination=sprintf("%s_subset", fl))
{
    ## open input stream
    stream <- open(FastqStreamer(fl))
    on.exit(close(stream))
    repeat {
        ## input chunk
        fq <- yield(stream)
        if (length(fq) == 0)
            break
        ## trim and filter, e.g., reads cannot contain 'N'...
        fq <- fq[nFilter()(fq)]  # see ?srFilter for pre-defined filters
        ## trim as soon as 2 of 5 nucleotides has quality encoding less
        ## than "4" (phred score 20)
        fq <- trimTailw(fq, 2, "4", 2)
        ## drop reads that are less than 36nt
        fq <- fq[width(fq) >= 36]
        ## append to destination
        writeFastq(fq, destination, "a")
    }
}

This is memory efficient and flexible. Care must be taken to coordinate pairs of FASTQ files representing paired-end reads, to preserve order.

4 Using ShortRead for data exploration

4.1 Data I/O

ShortRead provides a variety of methods to read data into R, in addition to readAligned.

4.1.1 readXStringColumns

readXStringColumns reads a column of DNA or other sequence-like data. For instance, the Solexa files s_N_export.txt contain lines with the following information:

## location of file
exptPath <- system.file("extdata", package="ShortRead")
sp <- SolexaPath(exptPath)
pattern <- "s_2_export.txt"
fl <- file.path(analysisPath(sp), pattern)
strsplit(readLines(fl, n=1), "\t")
## [[1]]
##  [1] "HWI-EAS88"                           "3"                                  
##  [3] "2"                                   "1"                                  
##  [5] "451"                                 "945"                                
##  [7] ""                                    ""                                   
##  [9] "CCAGAGCCCCCCGCTCACTCCTGAACCAGTCTCTC" "YQMIMIMMLMMIGIGMFICMFFFIMMHIIHAAGAH"
## [11] "NM"                                  ""                                   
## [13] ""                                    ""                                   
## [15] ""                                    ""                                   
## [17] ""                                    ""                                   
## [19] ""                                    ""                                   
## [21] ""                                    "N"
length(readLines(fl))
## [1] 1000

Column 9 is the read, and column 10 the ASCII-encoded Solexa Fastq quality score; there are 1000 lines (i.e., 1000 reads) in this sample file.

Suppose the task is to read column 9 as a DNAStringSet and column 10 as a BStringSet. DNAStringSet is a class that contains IUPAC-encoded DNA strings (IUPAC code allows for nucleotide ambiguity); BStringSet is a class that contains any character with ASCII code 0 through 255. Both of these classes are defined in the Biostrings package. readXStringColumns allows us to read in columns of text as these classes.

Important arguments for readXStringColumns are the dirPath in which to look for files, the pattern of files to parse, and the colClasses of the columns to be parsed. The dirPath and pattern arguments are like list.files. colClasses is like the corresponding argument to read.table: it is a list specifying the class of each column to be read, or NULL if the column is to be ignored. In our case, there are 21 columns, and we would like to read in columns 9 and 10. Hence

colClasses <- rep(list(NULL), 21)
colClasses[9:10] <- c("DNAString", "BString")
names(colClasses)[9:10] <- c("read", "quality")

We use the class of the type of sequence (e.g., DNAString or BString), rather than the class of the set that we will create ( e.g., DNAStringSet or BStringSet). Applying names to colClasses is not required, but makes subsequent manipulation easier. We are now ready to read our file

cols <- readXStringColumns(analysisPath(sp), pattern, colClasses)
cols
## $read
## DNAStringSet object of length 1000:
##        width seq
##    [1]    35 CCAGAGCCCCCCGCTCACTCCTGAACCAGTCTCTC
##    [2]    35 AGCCTCCCTCTTTCTGAATATACGGCAGAGCTGTT
##    [3]    35 ACCAAAAACACCACATACACGAGCAACACACGTAC
##    [4]    35 AATCGGAAGAGCTCGTATGCCGGCTTCTGCTTGGA
##    [5]    35 AAAGATAAACTCTAGGCCACCTCCTCCTTCTTCTA
##    ...   ... ...
##  [996]    35 GTGGCAGCGGTGAGGCGGCGGGGGGGGGTTGTTTG
##  [997]    35 GTCGGAGGTCAGCAAGCTGTAGTCGGTGTAAAGCT
##  [998]    35 GTCATAAATTGGACAGTGTGGCTCCAGTATTCTCA
##  [999]    35 ATCTACATTAAGGTCAATTACAATGATAAATAAAA
## [1000]    35 TTCTCAGCCATTCAGTATTCCTCAGGTGAAAATTC
## 
## $quality
## BStringSet object of length 1000:
##        width seq
##    [1]    35 YQMIMIMMLMMIGIGMFICMFFFIMMHIIHAAGAH
##    [2]    35 ZXZUYXZQYYXUZXYZYYZZXXZZIMFHXQSUPPO
##    [3]    35 LGDHLILLLLLLLIGFLLALDIFDILLHFIAECAE
##    [4]    35 JJYYIYVSYYYYYYYYSDYYWVUYYNNVSVQQELQ
##    [5]    35 LLLILIIIDLLHLLLLLLLLLLLALLLLHLLLLEL
##    ...   ... ...
##  [996]    35 ZZZZZZZYZZYUYZYUYZKYUDUZIYYODJGUGAA
##  [997]    35 ZZZZZZZZZZZZZZZZZZYZZYXXZYSSXXUUHHQ
##  [998]    35 ZZZZZZZZZZZZZZZYZZZZYZZZZYZZXZUUUUS
##  [999]    35 ZZZZZZZZZZZYXZYZYZZYZYZZXKZSYXUUNUN
## [1000]    35 ZZZZZZZZZZZZZZYZZZZZZZZYYSYSZXUUUUU

The file has been parsed, and appropriate data objects were created.

A feature of readXStringColumns and other input functions in the ShortRead package is that all files matching pattern in the specified dirPath will be read into a single object. This provides a convenient way to, for instance, parse all tiles in a Solexa lane into a single DNAStringSet object.

There are several advantages to reading columns as XStringSet objects. These are more compact than the corresponding character representation:

object.size(cols$read)
## 51032 bytes
object.size(as.character(cols$read))
## 102128 bytes

They are also created much more quickly. And the DNAStringSet and related classes are used extensively in ShortRead, Biostrings, BSgenome and other packages relevant to short-read technology.

4.2 Sorting

Short reads can be sorted using srsort, or the permutation required to bring the short read into lexicographic order can be determined using srorder. These functions are different from sort and order because the result is independent of the locale, and they operate quickly on DNAStringSet and BStringSet objects.

The function srduplicated identifies duplicate reads. This function returns a logical vector, similar to duplicated. The negation of the result from srduplicated is useful to create a collection of unique reads. An experimental scenario where this might be useful is when the sample preparation involved PCR. In this case, replicate reads may be due to artifacts of sample preparation, rather than differential representation of sequence in the sample prior to PCR.

4.3 Summarizing read occurrence

The tables function summarizes read occurrences, for instance,

tbls <- tables(fq)
names(tbls)
## [1] "top"          "distribution"
tbls$top[1:5]
## CTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGC 
##                                                                        7 
## GTTTGGTCTAGGGTGTAGCCTGAGAATAGGGGAAATCAGTGAATGAAGCCTCCTATGATGGCAAATACAGCT 
##                                                                        7 
## CGATAACGTTGTAGATGTGGTCGTTACCTAGAAGGTTGCCTGGCTGGCCCAGCTCGGCTCGAATAAGGAGGC 
##                                                                        6 
## CTAGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTA 
##                                                                        6 
## CACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCG 
##                                                                        5
head(tbls$distribution)
##   nOccurrences nReads
## 1            1  19291
## 2            2    247
## 3            3     34
## 4            4     18
## 5            5      3
## 6            6      2

The top component returned by tables is a list tallying the most commonly occurring sequences in the short reads. Knowledgeable readers will recognize the top-occurring read as a close match to one of the manufacturer adapters.

The distribution component returned by tables is a data frame that summarizes how many reads (e.g., 19291) are represented exactly 1 times.

4.4 Finding near matches to short sequences

Facilities exist for finding reads that are near matches to specific sequences, e.g., manufacturer adapter or primer sequences. srdistance reports the edit distance between each read and a reference sequence. srdistance is implemented to work efficiently for reference sequences whose length is of the same order as the reads themselves (10’s to 100’s of bases). To find reads close to the most common read in the example above, one might say

dist <- srdistance(sread(fq), names(tbls$top)[1])[[1]]
table(dist)[1:10]
## dist
##  0  4  6 10 14 18 20 21 31 32 
##  7  1  3  1  3  1  4  1  3 11

‘Near’ matches can be filtered, e.g.,

fqSubset <- fq[dist>4]

A different strategy can be used to tally or eliminate reads that consist predominantly of a single nucleotide. alphabetFrequency calculates the frequency of each nucleotide (in DNA strings) or letter (for other string sets) in each read. Thus one could identify and eliminate reads with more than 30 adenine nucleotides with

countA <- alphabetFrequency(sread(fq))[,"A"]
fqNoPolyA <- fq[countA < 30]

alphabetFrequency, which simply counts nucleotides, is much faster than srdistance, which performs full pairwise alignment of each read to the subject.

Users wanting to use R for whole-genome alignments or more flexible pairwise alignment are encouraged to investigate the Biostrings and pwalign packages, especially the PDict class and matchPDict and pairwiseAlignment functions.

5 Legacy support for early file formats

The ShortRead package contains functions and classes to support early file formats and ungapped alignments. Help pages are flagged as ‘legacy’; versions of ShortRead prior to 1.21 (Bioconductor version 2.13) contains a vignette illustrating common workflows with these file formats.

Session Info

sessionInfo()
## R version 4.6.1 (2026-06-24)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
## 
## Matrix products: default
## BLAS:   /home/biocbuild/bbs-3.24-bioc/R/lib/libRblas.so 
## LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.12.0  LAPACK version 3.12.0
## 
## locale:
##  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
##  [3] LC_TIME=en_GB              LC_COLLATE=C              
##  [5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
##  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
##  [9] LC_ADDRESS=C               LC_TELEPHONE=C            
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
## 
## time zone: America/New_York
## tzcode source: system (glibc)
## 
## attached base packages:
## [1] stats4    stats     graphics  grDevices utils     datasets  methods  
## [8] base     
## 
## other attached packages:
##  [1] ShortRead_1.71.1            GenomicAlignments_1.49.0   
##  [3] SummarizedExperiment_1.43.0 Biobase_2.73.1             
##  [5] MatrixGenerics_1.25.0       matrixStats_1.5.0          
##  [7] Rsamtools_2.29.0            GenomicRanges_1.65.0       
##  [9] Biostrings_2.81.5           Seqinfo_1.3.0              
## [11] XVector_0.53.0              IRanges_2.47.2             
## [13] S4Vectors_0.51.5            BiocParallel_1.47.0        
## [15] BiocGenerics_0.59.9         generics_0.1.4             
## [17] BiocStyle_2.41.0           
## 
## loaded via a namespace (and not attached):
##  [1] sass_0.4.10         SparseArray_1.13.2  bitops_1.0-9       
##  [4] jpeg_0.1-11         lattice_0.22-9      digest_0.6.39      
##  [7] RColorBrewer_1.1-3  evaluate_1.0.5      grid_4.6.1         
## [10] bookdown_0.47       fastmap_1.2.0       jsonlite_2.0.0     
## [13] Matrix_1.7-5        cigarillo_1.3.0     BiocManager_1.30.27
## [16] codetools_0.2-20    jquerylib_0.1.4     abind_1.4-8        
## [19] cli_3.6.6           rlang_1.3.0         crayon_1.5.3       
## [22] cachem_1.1.0        DelayedArray_0.39.3 yaml_2.3.12        
## [25] otel_0.2.0          S4Arrays_1.13.0     tools_4.6.1        
## [28] parallel_4.6.1      deldir_2.0-4        interp_1.1-6       
## [31] hwriter_1.3.2.1     png_0.1-9           R6_2.6.1           
## [34] lifecycle_1.0.5     pwalign_1.9.1       bslib_0.11.0       
## [37] Rcpp_1.1.2          xfun_0.59           knitr_1.51         
## [40] latticeExtra_0.6-31 htmltools_0.5.9     rmarkdown_2.31     
## [43] compiler_4.6.1