openPrimeR provides functionalities for designing and analyzing multiplex polymerase chain reaction (PCR) primers. In the following, we introduce typical workflows for three application scenarios, namely designing primers, analyzing primers, and comparing primer sets.
openPrimeR was developed to provide a rational approach for evaluating and designing primers for multiplex PCR such that multiple template sequences are amplified at the same time. The concept of coverage is of critical importance for multiplex PCR as it describes the number of templates that can be amplified with a set of primers. This package was specifically developed to enable researchers to evaluate the coverage of existing sets of primers as well as to design novel primer sets that maximize the coverage with a minimal number of primers. To provide a user-friendly tool, we created a Shiny app, which is available through the openPrimeRui package. The openPrimeR package enables the computation of the most important PCR-related physicochemical properties of primers to gauge whether a set of primers can provide high yields. The following list provides research questions that may be answered using openPrimeR:
openPrimeR requires external programs for some features, particularly for computing the physicochemical properties of primers. Please make sure you have the following tools installed on your system such that they are in your system’s path:
If you would like to be able to access the immunoglobulin repository IMGT from the openPrimeR Shiny app, you should additionally fulfill the following dependencies:
openPrimeR will automatically check for all dependencies and inform you about any missing dependencies when the package is attached:
Note that the tool is still functional if there are missing external programs. However, we recommend that all dependencies are fulfilled to guarantee the best user experience.
If you would like to use the openPrimer shiny application, please install the openPrimeRui package and consider its documentation. In the following, we will solely focus on the openPrimeR package itself and not on the frontend.
In order to design primers, we only need to load a set of template sequences and define the target binding regions. To analyze and compare the properties of existing primer sets, we also need to load one or multiple sets of primers. The following table summarizes the possible input data formats for each task:
| Task | Templates | Primers | Input file format |
|---|---|---|---|
| Design primers | ✓ | FASTA, CSV | |
| Analyze primers | ✓ | ✓ | FASTA, CSV |
| Compare primers | ✓ | ✓ | FASTA, CSV |
To load a set of template sequences, we simply input the path to a
valid FASTA
file and use read_templates(). In the following code
snippet, we store the path to a FASTA file that is provided with the
package in fasta.file. This file contains the template
sequences. In our case, we will load sequences of the human heavy chain
immunoglobulin genes:
# Specify a FASTA file containing the templates:
fasta.file <- system.file("extdata", "IMGT_data", "templates",
"Homo_sapiens_IGH_functional_exon.fasta", package = "openPrimeR")
# Load the template sequences from 'fasta.file'
seq.df.simple <- read_templates(fasta.file)Having loaded the template sequences successfully, we can investigate
the structure of seq.df.simple, which is a
Templates object. Since the Templates class is
derived from data.frame, you can use it in the same was as
any data frame. For example, we can retrieve the header of the first
template sequence via
seq.df.simple$Header[1]
#> [1] ">M99641|IGHV1-18*01|Homo sapiens|F|L-PART1+V-EXON|47..92+177..483|353 nt|1| | | | |353+0=353| | |"As you can see, the headers of the templates contain several pieces
of information that are separated by pipe symbols (|),
among others:
To load these annotations into the Templates object, we
will now provide additional arguments to read_templates().
We are particularly interested in loading the group information as this
information is important for interpreting the results later. In the next
code snippet, we use the hdr.structure variable to annotate
the meta-information that is provided by the headers of the FASTA file.
Moreover, we provide the delim argument to
read_templates() to specify that the pipe symbol is used to
separated individual fields and supply the id.column
argument to identify which field should be used as the identifier in the
Templates object:
hdr.structure <- c("ACCESSION", "GROUP", "SPECIES", "FUNCTION")
seq.df <- read_templates(fasta.file, hdr.structure, delim = "|", id.column = "GROUP")Since we have specified to load the accession, group, species, and
function from the FASTA headers, we can now retrieve these values from
seq.df. For example, for the first template we can retrieve
the following information:
# Show the loaded metadata for the first template
c(seq.df$Accession[1], seq.df$Group[1], seq.df$Species[1], seq.df$Function[1])
#> [1] "M99641" "IGHV1" "Homo sapiens" "F"
# Show the ID (group) of the first template
seq.df$ID[1]
#> [1] "IGHV1-18*01"Note that only the GROUP annotation has an impact on the
analysis in terms of visualizing the results later. The other fields can
be set arbitrarily and do not have any impact. If there is no metadata
that you wish to load, you can simply use the
read_templates() call used to declare
seq.df.simple. In this case, all templates are considered
to belong to a single default group.
Upon loading templates with read_templates(), the primer
binding region is set to the first 30 bases for forward primers and to
the last 30 bases for reverse primers, where first refers to
the 5’ end and last refers to the 3’ end. We can review the
target binding regions of forward and reverse primers by accessing
seq.df$Allowed_fw or seq.df$Allowed_rev,
respectively:
# Show the binding region of the first template for forward primers
seq.df$Allowed_fw[1]
#> [1] "atggactggacctggagcatccttttcttg"
# Show the corresponding interval in the templates
c(seq.df$Allowed_Start_fw[1], seq.df$Allowed_End_fw[1])
#> [1] 1 30
# Show the binding region of the first template for reverse primers
seq.df$Allowed_rev[1]
#> [1] "cgacacggccgtgtattactgtgcgagaga"
# Show the corresponding interval in the templates
c(seq.df$Allowed_Start_rev[1], seq.df$Allowed_End_rev[1])
#> [1] 324 353In the following sections, we describe two ways in which the primer
binding regions can be defined using
assign_binding_regions().
To assign a uniform target binding region to all templates, you can
specify positional intervals indicating the binding regions for forward
and reverse primers. For forward primers, the interval is specified
relative to the template 5’ end, while for reverse primers, the interval
is specified relative to the 3’ end. In the following example, we set
the binding region of forward primers (fw) to the first 50
template bases and to the last 40 bases for reverse primers
(rev):
Note that we have supplied the interval [1,40] to allow binding in the last 40 bases of the templates for reverse primers. This is because the binding region for reverse primers is provided relative to the 3’ end, while the binding region of forward primers is provided relative to the 5’ end. In this way, the reverse binding region can be annotated independent of the length of individual templates.
Let’s verify the different binding regions for forward and reverse primers using the first template sequence:
Individual binding regions can be assigned to each template by
providing a FASTA file for each primer direction containing the target
binding regions for the primers. The FASTA headers of these files should
match the headers in the template FASTA file that was provided earlier.
In the following example, we use a FASTA file that is provided with the
package to define the individual binding regions for the forward primers
only. In this case, the FASTA file specifies the leaders of the human
heavy chain immunoglobulin sequences that have been loaded in
seq.df:
l.fasta.file <- system.file("extdata", "IMGT_data", "templates",
"Homo_sapiens_IGH_functional_leader.fasta", package = "openPrimeR")
template.df <- assign_binding_regions(seq.df, fw = l.fasta.file, rev = NULL)The binding regions for forward primers may now be different for each template. For example, the binding regions for the following two templates occur at different positions in the templates:
# An example of two templates with different binding regions
c(template.df$Allowed_Start_fw[1], template.df$Allowed_End_fw[1])
#> [1] 1 57
c(template.df$Allowed_Start_fw[150], template.df$Allowed_End_fw[150])
#> [1] 1 60Note, that since we did not supply individual binding regions for reverse primers, their binding regions were not adjusted:
Before we can start an analysis, we need to define the analysis settings. openPrimeR supplies predefined XML files specifying default settings for different applications:
list.files(system.file("extdata", "settings", package = "openPrimeR"), pattern = "*\\.xml")
#> [1] "A_Taq_PCR_design.xml" "B_Taq_PCR_evaluate.xml"
#> [3] "C_Taq_PCR_high_stringency.xml"In our case, we select the high-stringency primer design conditions
for Taq polymerase and load the DesignSettings object with
read_settings()):
settings.xml <- system.file("extdata", "settings",
"C_Taq_PCR_high_stringency.xml", package = "openPrimeR")
settings <- read_settings(settings.xml)You can use str(settings) to explore the structure of
settings:
| Slot | Getter/Setter | Purpose |
|---|---|---|
Input_Constraints |
constraints() |
Desired values for primer properties |
Input_Constraint_Boundaries |
constraintLimits() |
Limits for relaxing constraints during primer design |
Coverage_Constraints |
cvg_constraints() |
Constraints for estimating the coverage |
PCR_conditions |
PCR() |
Experimental PCR conditions |
constraint_settings |
conOptions() |
Settings for evaluating the constraints |
Since the settings object contains all the relevant
information for the analysis of primers, you should review and possibly
customize the settings before starting an analysis. Particularly make
sure that the PCR conditions specified in the settings agree with your
experimental conditions. For example, the PCR sodium ion concentration
can be accessed via PCR(settings)$Na_concentration.
Moreover, the coverage constraints should typically contain one
constraint (e.g. coverage_model,
primer_efficiency, or annealing_DeltaG).
Moreover, for designing primers, you should select a coverage constraint
that provides highly specific coverage calls. For the purpose of this
vignette, however, we will not apply any coverage constraints and
instead stringently limit the number of mismatches between primers and
templates:
# No constraints on primer coverage (not recommended!)
cvg_constraints(settings) <- list()
# Instead consider all primers binding with up to 3 mismatches to cover the corresponding templates
conOptions(settings)$allowed_mismatches <- 3You should also make sure that the requirements physicochemical constraints for high-quality primers fulfill your expectations. For example, if we do not want to filter designed primers using the GC clamp criterion, we can remove the requirement for a GC clamp in the following way:
design.settings <- settings
constraints(design.settings) <- constraints(design.settings)[!grepl(
"gc_clamp", names(constraints(design.settings)))]We may also want to design only primers of a specific length. To generate only primers of length 25, we could specify this via
For designing primers we may also want to prevent any mismatch binding. To implement this, we simply set
For more possible customizations, please refer to the documentation
of the settings class, which can be accessed via
?DesignSettings.
Having customized the settings, we can store the modified settings to disk in the following way:
The next time we want to perform an analysis, we can simply load the
stored settings using the read_settings function using
out.file as an argument.
Since the loaded template sequences contain only the variable region
of the human immunoglobulins and not the constant region, we will
restrict ourselves to designing only forward primers. To design primers,
we need only a single function, namely design_primers(),
which requires the settings specified in design.settings
and the templates and binding regions provided in
template.df. By setting mode.directionality to
‘fw’, we specify that we want to design forward primers only. The other
possible choices are rev for designing only reverse primers
and both for designing both forward and reverse primers.
Moreover, we subset template.df to the first two template
sequences to limit the runtime of the design procedure for this
example:
# Design forward primers for the first two templates
optimal.primers <- design_primers(template.df[1:2,], mode.directionality = "fw",
settings = design.settings)optimal.primers is a list in which the optimal primers
are stored in optimal.primers$opti and the corresponding
filtered primers are stored in optimal.primers$filtered.
The optimal primer sets for all evaluated melting temperatures are
stored in optimal.primers$all_results.
The primer design function can be customized in many ways. The
init.algo argument can be used to specify how the initial
set of primers is generated. By default, this is done by extracting
substrings from the template sequences (‘naive’). A tree-based
initialization strategy producing degenerate primers can be activated by
setting init.algo to ‘tree’, which is favorable for related
template sequences.
Another important argument is required.cvg, which
defines the desired coverage ratio of the templates. By default, this is
set to 1 indicating that 100% of templates should be covered. If the
desired coverage cannot be reached with a primer set fulfilling all
properties specified via the settings argument, the
constraints are relaxed in order to reach the target coverage. This
behavior can be deactivated by setting required.cvg to
0.
The opti.algo argument specifies the algorithm that is
used for optimizing the primer sets. By default, this is a greedy
algorithm (‘Greedy’), but we can also select an integer linear program
(‘ILP’). The ILP ensures that designed primer sets are minimal, but this
comes at the cost of a worst-case exponential runtime. Hence, the ILP is
recommended for small template sets. For larger sets of templates, the
default (‘Greedy’) should be used, which provides an approximate
solution in polynomial runtime.
To conclude the primer design task, let’s store the designed primers as a FASTA file:
In the following, we will analyze the physicochemical properties of an existing primer set. Since the set of primers we have designed earlier is quite small, we will load a new set of primers first.
Similarly to templates, primers can also be loaded from a FASTA file.
Similarly to ensuring that the information in the header is loaded
correctly via read_templates(), you should make sure that
the primer directionalities are correctly annotated in the FASTA file.
This means that the header of every primer should contain a keyword that
uniquely identifies the primer to either be a forward or reverse primer.
The FASTA file we are going to load contains the forward primers that
were designed for the variable region of human IGH genes by Ippolito et al..
Since all primers are forward primers, the headers of all primers in the
FASTA file are annotated with the ‘_fw’ keyword. Therefore, we set the
fw.id argument for read_primers()
accordingly:
# Define the FASTA primer file to load
primer.location <- system.file("extdata", "IMGT_data", "primers", "IGHV",
"Ippolito2012.fasta", package = "openPrimeR")
# Load the primers
primer.df <- read_primers(primer.location, fw.id = "_fw")We can view the identifiers and sequences of the primers in the following way:
print(primer.df[, c("ID", "Forward")])
#> ID Forward
#> 2 Ippolito2012|VH1|1_fw caggtccagctkgtrcagtctgg
#> 1 Ippolito2012|VH157|2_fw caggtgcagctggtgsartctgg
#> 3 Ippolito2012|VH2|3_fw cagrtcaccttgaaggagtctg
#> 5 Ippolito2012|VH3|4_fw gaggtgcagctgktggagwcy
#> 7 Ippolito2012|VH4|5_fw caggtgcagctgcaggagtcsg
#> 6 Ippolito2012|VH4-DP63|6_fw caggtgcagctacagcagtggg
#> 8 Ippolito2012|VH6|7_fw caggtacagctgcagcagtca
#> 4 Ippolito2012|VH3N|8_fw tcaacacaacggttcccagttaTo determine which biochemical constraints are fulfilled by the
loaded primers, we can use check_constraints(), which
requires only the set of primers, a set of templates, and a settings
object. Since we want to determine the coverage of the primers along the
full template sequence, we will set the allowed ratio of off-coverage
events to 100% by modifying the constraint settings. We then call
check_constraints() in order to determine all constraints
defined in settings:
# Allow off-target coverage
conOptions(settings)$allowed_other_binding_ratio <- c("max" = 1.0)
# Evaluate all constraints found in 'settings'
constraint.df <- check_constraints(primer.df, template.df,
settings, active.constraints = names(constraints(settings)))Note that we could have also computed only a subset of the
constraints specified via settings, if we had passed the
active.constraints argument to
check_constraints(). The constraint.df
variable provides a Primers data frame containing the
results from evaluating all constraints provided via
settings (e.g. primer coverage, GC ratio, melting
temperature). We can retrieve the values of individual constraints by
accessing the corresponding columns in constraint.df. In
the following, we will explore the coverage of templates in more
detail.
The number of templates that are covered by each primer is annotated
in the primer_coverage column:
To identify the primers that cover individual templates, we can
annotate the coverage information in the template data frame using
update_template_cvg():
Now, the primer_coverage column is also available in
template.df such that we can identify the number of primers
that cover the first five templates in the set:
The overall ratio of covered template sequences can be retrieved via
get_cvg_ratio():
The output indicates that the primer set is expected to amplify
99.35% of templates according to the currently specified conditions for
primer coverage (at most 3 mismatches). We can learn more about the
coverage by computing further statistics. For example, we may be
interested in identifying which groups of templates are expected to be
amplified and which are not. For this purpose, we can use
get_cvg_stats(), which provides information on the number
of covered template sequences according to their group annotation:
| Group | Coverage |
|---|---|
| Total | 154 of 155 (99.35%) |
| IGHV1 | 25 of 25 (100%) |
| IGHV2 | 21 of 21 (100%) |
| IGHV3 | 55 of 56 (98.21%) |
| IGHV4 | 47 of 47 (100%) |
| IGHV5 | 3 of 3 (100%) |
| IGHV6 | 2 of 2 (100%) |
| IGHV7 | 1 of 1 (100%) |
In this case, we see that all but a single template of IGHV3 does not seem to be covered by the primer set. A visualization of the coverage can be obtained via
This plot shows three bars:
For the loaded set of primers, the identity coverage is nearly as high as the expected coverage, which indicates that the analyzed primer set should have a high amplification fidelity. Note that for IGHV5, the identity coverage is 0%, while the expected coverage is 100%. This just shows that there is no primer that is fully complementary to any of the IGHV5 templates, however, according to the coverage conditions there are primers that are expected to cover all of the IGHV5 templates via mismatch binding.
Typically one wants to avoid large primer sets for reasons of cost
and priming efficiency. We provide a method for reducing the size of an
existing primer set by computing optimal subsets with respect to the
coverage of templates. Using this approach, it is possible to limit the
size of a primer set without sacrificing any coverage. We can compute
all optimal subsets of a primer set for which the coverage has already
been annotated using subset_primer_set():
primer.subsets is a list whose i-th entry
contains the primer set of size i. For example, the optimal
subset of size 3 could be accessed via primer.subsets[[3]].
We can easily determine the most suitable subset by plotting the
coverage of all optimal subsets:
plot_primer_subsets(primer.subsets, template.df)
#> Warning: Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
#> ℹ Please use `linewidth` instead.
#> ℹ The deprecated feature was likely used in the openPrimeR package.
#> Please report the issue to the authors.
#> This warning is displayed once per session.
#> Call `lifecycle::last_lifecycle_warnings()` to see where this warning was
#> generated.The plot visualizes two types of information. The line graph shows the total percentage of covered templates, while the stacked bars indicate the coverage of individual primers. Since some of the primers in the set cover the same templates, the cumulative coverage of the stacked bars exceeds 100% for subsets of size 3 or larger, although the total coverage already seems to be saturated for the subset of size 3. It seems that subsets with more than 3 primers offer only additional redundant coverage of the templates. Hence, we might decide to select the primer subset of size 3 as it seems to achieve the same coverage as the full primer set:
We can verify that the coverages of the full primer set and the
subset of size 3 seem to match using get_cvg_ratio():
original.cvg <- as.character(get_cvg_ratio(constraint.df, template.df, as.char = TRUE))
subset.cvg <- as.character(get_cvg_ratio(my.primer.subset, template.df, as.char = TRUE))
print(paste0("Coverage (n=", nrow(constraint.df), "): ", original.cvg, "; Subset Coverage (n=", nrow(my.primer.subset), "): ", subset.cvg))
#> [1] "Coverage (n=8): 99.35%; Subset Coverage (n=3): 98.71%"The binding regions of the primers in the templates can be visualized
with plot_primer_binding_regions():
The x-axis of the plot shows the binding positions of the primers
relative to the target binding regions. Position -1
indicates the end of the target binding region and we can see that all
primers bind beyond the target region. Since we have specified the
leader of the immunoglobulins as the target region, this just means that
all primers bind at the beginning of the exon, which ensures that the
full antibody sequence is recovered by the primers. Typical primer sets
for amplifying immunoglobulins will target the exon, that is, the region
directly following the leader. To investigate the individual positions
of primer binding for individual templates, we can use
plot_primer(). In this case, we just provide the first
primer and the first ten templates to the plotting function in order to
restrict the dimension of the plot:
The plot shows primers that cover a template as arrows above the corresponding templates. If a template is covered it is shown as a black line and otherwise it is shown in grey.
We can determine which primers passed the physicochemical constraints
that were supplied to the check_constraints function
through visual inspection via plot_constraints():
The plot shows which constraints are passed (blue) and which constraints are failed (red) for every primer. For example, looking at the column indicating the GC clamp constraint, we see that only Ippolito2012|VH3|4_fw and Ippolito2012|VH6|7_fw and Ippolito2012|VH3N|8_fw did not fulfill our requirements for the GC clamp. This is because both primers have no GC clamp, although we required a GC clamp with a length between 1 and 3 in the settings:
# View the number of terminal GCs for primers failing the GC constraint
constraint.df$gc_clamp_fw[!constraint.df$EVAL_gc_clamp]
#> [1] 0 0 0
# View the desired number of terminal GCs:
constraints(settings)$gc_clamp
#> min max
#> 1 3If you are wondering why the specificity of all evaluated primer seems so low, this can be explained by the binding regions of the primers. As we have seen earlier, all primers bind outside the target binding region. Therefore, the specificity of every primer is 0% and the constraint on the specificity of the primers is never fulfilled.
We can not only can visualize whether a primer passed a specific constraint, but also view the distribution of values corresponding to a specific property. For example, let us take a look at the number of terminal GCs in the primers by creating a histogram:
The y-axis shows the number of primers exhibiting a certain number of
GCs at their 3’ ends. The dashed lines indicate the desired extent of
the GC clamp according to the settings object that we passed to
plot_constraint().
All our previous evaluations were performed without requiring the primers to actually fulfill any of the constraints we postulated. We can filter primers according to a set of biochemical constraints such that only primers fulfilling all requirements are retained. For example, if we want to select only primers fulfilling the requirements for GC clamp and melting temperature range, we could obtain the filtered data set in the following way:
filtered.df <- filter_primers(constraint.df, template.df, settings,
active.constraints = c("gc_clamp", "gc_ratio"))Now, we could perform further analyses on this data set. For example,
using get_cvg_ratio(), we could determine that the
percentage of templates that are covered by the filtered primer set is
only 13.55% since only 1 primer remains after filtering.
We can create a PDF report that summarizes the analysis of a set of
primers by passing an analyzed primer set with its corresponding
templates and settings to create_report():
# Define the path to the output file
my.file <- tempfile(fileext = ".pdf")
# Store a PDF report for 'constraint.df' in 'my.file'
create_report(constraint.df, template.df, my.file,
settings, sample.name = "My analysis")Note that this function requires pandoc as well as
LaTeX such that rmarkdown can create the PDF
report.
To compare existing primer sets, it is necessary to precompute all
constraints of interest for each of the primer sets, which can be done
with check_constraints() as we have demonstrated earlier.
Instead of evaluating multiple primer sets, we will simply load
pre-evaluated sets of primers and template sets that were stored as CSV
files. For example, we could have stored our previous evaluation results
in the following way in order to load these data later:
primer.xml <- tempfile("my_primers", fileext =".csv")
write_primers(constraint.df, primer.xml, "CSV")
template.xml <- tempfile("my_templates", fileext = ".csv")
write_templates(constraint.df, template.xml, "CSV")For the following example, we will simply load primers and templates that are shipped with the openPrimeR package:
# Define the primer sets we want to load
sel.sets <- c("Glas1999", "Rubinstein1998", "Cardona1995", "Persson1991", "Ippolito2012", "Scheid2011")
# List all available IGH primer sets
primer.files <- list.files(path = system.file("extdata", "IMGT_data", "comparison",
"primer_sets", "IGH", package = "openPrimeR"),
pattern = "*\\.csv", full.names = TRUE)
# Load all available primer sets
primer.data <- read_primers(primer.files)
# Select only the sets defined via 'sel.sets'
sel.idx <- which(names(primer.data) %in% sel.sets)
primer.data <- primer.data[sel.idx]
# Provide a set of templates for every primer set
template.files <- rep(system.file("extdata", "IMGT_data", "comparison", "templates",
"IGH_templates.csv", package = "openPrimeR"),
length(primer.data))
template.data <- read_templates(template.files)Both, primer.data and template.data are
lists containing primer and template data frames, respectively. Note
that these lists should always have the same lengths, that is, every
primer set should have an associated template set and vice versa. Having
loaded the primer and template data sets, we can plot an overview of the
constraints that are fulfilled by the primers in each set:
In this plot, each facet corresponds to a primer set and each physicochemical constraint is shown as a colored bar whose height indicates the percentage of primers fulfilling the constraint. An intuitive interpretation of the plot is that sets with high-quality primers should have many high bars. For example, we can quickly see that the primers from Persson et al. (1991) do not have any primers fulfilling our requirements for the ratio of GC, which should be between 1 and 3 according to the loaded settings in order to ensure similar binding behaviors of the primers.
The distribution of each evaluated constraint can be investigated in more detail. For example, to investigate the influence of the GC ratios on the melting temperatures of the primers in each set, we can create the following boxplot:
In the boxplot, each dot corresponds to a single primer and the boxes show the 1st, 2nd, and 3rd quartiles, from bottom to top. Since we have provided the current constraint settings to the plotting function, the desired ranges for GC ratios and melting temperatures are indicated as horizontal dashed lines in the plot. The plot shows that the GC ratios from the primers in the set from Cardona et al. (1995) are all in the desired range and have a small spread, while the GC ratios of other primer sets have much larger spreads, for example those from the set of Glas et al. (1999). The visualization reveals the association between GC ratios and melting temperatures. The primer sets from Cardona, Persson, and Rubinstein all have small deviations in their GC ratios effecting small deviations in their melting temperatures, while the other primer sets exhibit high variances for both properties.
Remember that the plot we generated using
plot_constraint_fulfillment() revealed that most of the
loaded primer sets failed the specificity constraint. By plotting the
binding regions for each of the primer sets through
plot_primer_binding_regions() we can find out why this is
the case:
The plot reveals that only the primers from Scheid et al. mostly bind in the target region, while the other primer sets all bind outside the target region. Moreover, since we have evaluated the primers allowing for off-target binding, we find that the forward primers from Glas et al. do not seem to target the 5’ region of the templates but are rather spread along the length of the templates, a property that would be detrimental when trying to amplify complete antibody cDNA.
For brevity’s sake, we did not provide explanations and examples for
all possible uses of the package. If you would like to learn more about
how you can use openPrimeR, please consider using our interactive
tutorial. The tutorial is provided as a Shiny app, which can be started
via runTutorial().